ID: 1142149983

View in Genome Browser
Species Human (GRCh38)
Location 16:88508475-88508497
Sequence AGGCCTGTGGTTGGACTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 249}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142149983_1142149997 18 Left 1142149983 16:88508475-88508497 CCACAGAGTCCAACCACAGGCCT 0: 1
1: 0
2: 1
3: 19
4: 249
Right 1142149997 16:88508516-88508538 CCCTGGTCTCTCCTGGGCACAGG 0: 1
1: 1
2: 4
3: 68
4: 590
1142149983_1142149994 12 Left 1142149983 16:88508475-88508497 CCACAGAGTCCAACCACAGGCCT 0: 1
1: 0
2: 1
3: 19
4: 249
Right 1142149994 16:88508510-88508532 GGGTTCCCCTGGTCTCTCCTGGG No data
1142149983_1142149993 11 Left 1142149983 16:88508475-88508497 CCACAGAGTCCAACCACAGGCCT 0: 1
1: 0
2: 1
3: 19
4: 249
Right 1142149993 16:88508509-88508531 TGGGTTCCCCTGGTCTCTCCTGG 0: 1
1: 0
2: 1
3: 36
4: 239
1142149983_1142149988 -9 Left 1142149983 16:88508475-88508497 CCACAGAGTCCAACCACAGGCCT 0: 1
1: 0
2: 1
3: 19
4: 249
Right 1142149988 16:88508489-88508511 CACAGGCCTTGGGCTCCACGTGG 0: 1
1: 0
2: 2
3: 18
4: 234
1142149983_1142149989 -8 Left 1142149983 16:88508475-88508497 CCACAGAGTCCAACCACAGGCCT 0: 1
1: 0
2: 1
3: 19
4: 249
Right 1142149989 16:88508490-88508512 ACAGGCCTTGGGCTCCACGTGGG 0: 1
1: 0
2: 2
3: 12
4: 113
1142149983_1142149991 1 Left 1142149983 16:88508475-88508497 CCACAGAGTCCAACCACAGGCCT 0: 1
1: 0
2: 1
3: 19
4: 249
Right 1142149991 16:88508499-88508521 GGGCTCCACGTGGGTTCCCCTGG 0: 1
1: 0
2: 3
3: 11
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142149983 Original CRISPR AGGCCTGTGGTTGGACTCTG TGG (reversed) Intronic
902171266 1:14613274-14613296 AGGCCGGGGATTGTACTCTGAGG + Intronic
904908774 1:33918273-33918295 ATGCCTGTGGTGGGACCCTGCGG - Exonic
908351026 1:63286452-63286474 AGGCCTGGAGGTGGAGTCTGAGG - Intergenic
910663779 1:89702177-89702199 AGACCTATTGGTGGACTCTGGGG + Intronic
913511897 1:119569730-119569752 AGGCCTGTGGTTGGGTGCTATGG - Intergenic
913530461 1:119730515-119730537 ATGCCTGTGGATGGATTCTTTGG + Intronic
915044286 1:152999100-152999122 AGGCCTGTCTTTGGAGACTGTGG - Intergenic
917525083 1:175781343-175781365 AGGCCAGTGGCTGGAGTCAGAGG - Intergenic
917534200 1:175862908-175862930 AGGCCTGTCCTTGGCCTCTCTGG - Intergenic
918239788 1:182611333-182611355 AGCCCTGGGGTTGGACCTTGTGG - Intergenic
920934506 1:210418519-210418541 AGGGCTGTGCTTGTAGTCTGGGG + Intronic
922786828 1:228287054-228287076 TGGCCTGTGGCTGGGCTTTGGGG - Intronic
923694498 1:236233891-236233913 AGGCCAGAGGTTGGGCTCTAGGG + Intronic
924865564 1:247975673-247975695 AGGCTAGTGCTTGGACTCTAAGG - Intronic
1062825426 10:564574-564596 AGGTCTGCCGCTGGACTCTGTGG + Intronic
1063361856 10:5466133-5466155 CGGCCTGGGGTTGGGCCCTGAGG - Intergenic
1064035115 10:11908465-11908487 AGGCCTGGGGCTGGGGTCTGAGG - Intergenic
1067095926 10:43299846-43299868 AGGCCTGTAGTTGGAATCCATGG + Intergenic
1067588763 10:47492862-47492884 AGGCCTGTGGCAGGGGTCTGAGG + Intergenic
1067635889 10:48000953-48000975 AGGCCTGTGGCAGGGGTCTGAGG + Intergenic
1067657350 10:48206281-48206303 AGGCCTCTGGTCTGTCTCTGAGG - Intronic
1069256762 10:66342276-66342298 AGGCATTTTGTTGGGCTCTGAGG - Intronic
1070132451 10:73664960-73664982 AGGCCTGTGGCAGGGGTCTGAGG + Intergenic
1071609229 10:87019116-87019138 AGGCCTGTGGCAGGGGTCTGAGG - Intergenic
1072925458 10:99612991-99613013 AGGACTGAGGTGGGATTCTGTGG - Intronic
1073143450 10:101263846-101263868 AGGGCTGGGGTTGGGGTCTGAGG + Intergenic
1073241644 10:102062872-102062894 AGGCCAGGAGTTGGAGTCTGTGG - Intergenic
1074290300 10:112133257-112133279 AGGGTTCTGGTTGGACTGTGAGG + Intergenic
1074448915 10:113543073-113543095 TGGCCTGAGATTGGACTGTGTGG + Intergenic
1074917128 10:117968465-117968487 GGGGCTGTGGCTGGACCCTGGGG + Intergenic
1075581710 10:123623793-123623815 AGGCATTTGGTTGTAATCTGTGG - Intergenic
1076377802 10:130003234-130003256 GGACCTGTGCTGGGACTCTGAGG + Intergenic
1076980400 11:201107-201129 AGGCCTGGCCTTGGACTCTTGGG - Intronic
1077164550 11:1129207-1129229 AGGCCTATGGTTGGTCACGGAGG + Intergenic
1077168716 11:1156885-1156907 AGGTGTGTGGCTGGACACTGTGG - Intergenic
1078507990 11:11966273-11966295 AGGCCTGGGGTTGAGCTCAGTGG + Intronic
1079005644 11:16789663-16789685 AGCCCTGGGGATGGCCTCTGGGG - Intronic
1080156589 11:29118529-29118551 AGGATTGTGGCTGGACTCAGTGG + Intergenic
1080779418 11:35417716-35417738 ATGCCTTTGGAAGGACTCTGGGG + Intronic
1081572104 11:44298228-44298250 AGGCCTTTGGTGAGACTCAGGGG + Intronic
1083418614 11:62541157-62541179 AGGCCTGTGGCCTGTCTCTGGGG - Intronic
1084284903 11:68124789-68124811 AGGCCCGTGGGTGGACCCCGAGG - Intergenic
1084420957 11:69060343-69060365 AGGCCTGAGGTTTTCCTCTGTGG + Intronic
1085475925 11:76788911-76788933 AGGCCTGTGGGTAGCCTGTGGGG + Intronic
1088499942 11:110473304-110473326 AGGACTTTGGTTGTACTCAGTGG + Intergenic
1089826785 11:121284886-121284908 AGGCCTGTAGTTGGAATCCATGG - Intergenic
1090395039 11:126413499-126413521 AGGCCCGTGGTGGGCTTCTGAGG - Exonic
1090742242 11:129674957-129674979 AGGTCTGAGGATGGAGTCTGTGG + Intergenic
1092285770 12:7128597-7128619 ATGCCCGGGGTTGGACACTGTGG - Intronic
1094380776 12:29840760-29840782 AGGCCTTGGGTGAGACTCTGAGG - Intergenic
1096427020 12:51512550-51512572 AGGTCTGTGGCTGGTCACTGTGG + Exonic
1096452282 12:51753929-51753951 TGTCCTGTGGTTGGAATGTGAGG + Intronic
1096452322 12:51754497-51754519 TGTCCTGTGGTTGGAATGTGAGG + Intronic
1097516810 12:60617082-60617104 AGGCTTCTGGTTGACCTCTGTGG + Intergenic
1097874542 12:64631304-64631326 AGGCCTGGGGTGGAACTGTGTGG + Intronic
1101745480 12:107538253-107538275 AGGCCAGTTATTGGACTCAGTGG + Intronic
1102848187 12:116210606-116210628 AGGCATGTGGTTGGATTTTAGGG - Intronic
1102907790 12:116690301-116690323 TGGCCAGTGGTTGGAGACTGGGG + Intergenic
1103595936 12:122024130-122024152 AGGCCTGTAGTTGGAGCTTGAGG + Intronic
1104932802 12:132348713-132348735 AGGCCTGTAATTGGAACCTGTGG - Intergenic
1106699141 13:32210364-32210386 AGGGCTCAGGTTGGACTATGAGG + Intronic
1109807835 13:67467421-67467443 GAGCTTCTGGTTGGACTCTGCGG + Intergenic
1112315585 13:98359547-98359569 TGGCCTGTGGCTGTACTCGGAGG - Intronic
1112736339 13:102424011-102424033 AGGTCTGTTTTTGGACTCTCTGG - Intergenic
1115695909 14:35898384-35898406 AGCCCTCTGGGTGGACACTGGGG + Intronic
1117332862 14:54730849-54730871 AGCCCTGTGGTGGGAATCTTTGG - Intronic
1119645900 14:76348282-76348304 AGCCCTGTGGTGGGTGTCTGGGG + Intronic
1122404961 14:101495122-101495144 AGGCCTTTGGTTTTATTCTGTGG - Intergenic
1124259780 15:28178275-28178297 AGGCCTGGCCCTGGACTCTGGGG + Intronic
1126070534 15:44861715-44861737 AGGACTGTGGCTGGGCTCAGAGG + Intergenic
1127067706 15:55257635-55257657 AGGCCTAAGTTTGGAATCTGAGG - Intronic
1127275545 15:57440344-57440366 AGGCCTGTTGTTAGACCATGAGG - Intronic
1128800249 15:70492663-70492685 AGGCCTGTGCTTGGCCTGTGGGG - Intergenic
1129754810 15:78091665-78091687 AGGCCTGTGGTAGGAAGCTTTGG - Intronic
1132753501 16:1470516-1470538 AGGCCTCTCCTTGGTCTCTGTGG - Intronic
1132893696 16:2217360-2217382 AGGCCTGTCCTGTGACTCTGAGG - Intergenic
1132999339 16:2841230-2841252 TGGCCTGTGGTTGACCTCAGTGG - Intergenic
1133357330 16:5146218-5146240 GGGCCTGTGGTTGGACTTCCAGG + Intergenic
1133442692 16:5834023-5834045 AGGCCTGGGGCTGGACACTGAGG - Intergenic
1134115595 16:11545561-11545583 AAGCCTCTGGTTGGTGTCTGTGG - Intergenic
1134238567 16:12486836-12486858 AAGCCTGTGGATGAACTATGAGG - Intronic
1136254308 16:29028199-29028221 GGCCCTGTGGCTGGGCTCTGAGG + Intergenic
1136293330 16:29288659-29288681 CGGCCTGTGCTTGGTCTGTGGGG - Intergenic
1137540616 16:49359239-49359261 AGGCATGTGCATGAACTCTGGGG - Intergenic
1138474173 16:57260898-57260920 AGCCCTGTGGCTGGAGGCTGTGG - Intronic
1138475797 16:57270161-57270183 GGGACTGTGTTTGGACTCGGGGG - Intronic
1138475845 16:57270307-57270329 GGGGCTGTGGATGGACTCAGGGG - Intronic
1138524199 16:57592531-57592553 GGGCCTGGGGTTAGACTCCGTGG + Intergenic
1138845337 16:60558268-60558290 AGGCCTGAAGTTGGTCACTGAGG + Intergenic
1139430197 16:66907059-66907081 AGCCCAGGGGTTGGACTCTGAGG - Intergenic
1139896606 16:70292806-70292828 TGGCCTGTTGTTTCACTCTGCGG - Intronic
1140869808 16:79096153-79096175 AGGACTGTGGTCAGGCTCTGTGG - Intronic
1141891380 16:86928940-86928962 AGGCCAGTGGTGGGACTGGGAGG - Intergenic
1142099213 16:88262666-88262688 CGGCCTGTGCTTGGTCTGTGGGG - Intergenic
1142149983 16:88508475-88508497 AGGCCTGTGGTTGGACTCTGTGG - Intronic
1142983228 17:3683327-3683349 AGGTTTGGGGTTGGTCTCTGGGG - Intronic
1143349347 17:6276082-6276104 AGGCCTTTTGTTGGCCTCTGAGG - Intergenic
1145837036 17:27962207-27962229 AGGCTTGTGGCTTGACTCTCAGG - Intergenic
1145995743 17:29103804-29103826 AGGCACTGGGTTGGACTCTGGGG + Intronic
1146435812 17:32846148-32846170 AGGCCTGTTCCTGAACTCTGTGG - Intronic
1148142463 17:45338421-45338443 AGCCGTGTGGATGGACTCAGTGG - Intergenic
1150804297 17:68307091-68307113 AGGCCTGTGCTGTGGCTCTGAGG + Exonic
1151283612 17:73094178-73094200 AGGCCTGTTATTGGACCCTTTGG - Intergenic
1152587623 17:81196077-81196099 AGGTTTGTGGATGGACCCTGGGG + Intronic
1152640004 17:81445406-81445428 TGGCTTGTGGGTGGACTTTGGGG - Exonic
1156402567 18:36753174-36753196 AGGCCTGTGGTCCTACCCTGTGG + Intronic
1157419208 18:47531336-47531358 AGGCCTGGAGATGGGCTCTGAGG + Intergenic
1158540599 18:58350189-58350211 AGGGCAGTGGTTGGACTCCAAGG + Intronic
1160480843 18:79238465-79238487 CGGGCTGTAGCTGGACTCTGAGG + Intronic
1160483917 18:79270826-79270848 GGGCCTGTGCCTGAACTCTGGGG - Intronic
1160934132 19:1585251-1585273 AGGCCTGGGTTTGGGGTCTGGGG - Intronic
1161000639 19:1909159-1909181 AGGCCTGCGGTGCGAGTCTGTGG + Intronic
1161290481 19:3491233-3491255 AGGCTTGGGGTGGGACTCTGCGG - Exonic
1163338727 19:16690346-16690368 AGGCATGTGGCTGGGCTCAGTGG - Intergenic
1163809937 19:19424699-19424721 ACACCTGTGGTTGGGGTCTGGGG + Intronic
1164828452 19:31301626-31301648 AGGCCTGAGGGTGGACCTTGCGG - Intronic
1165068887 19:33243879-33243901 AGGTCTTTGGTTTTACTCTGGGG - Intergenic
1165137482 19:33678833-33678855 AGTCCAGTGGTTGTGCTCTGTGG - Intronic
1166038898 19:40190904-40190926 GGGCCGGTGGCGGGACTCTGCGG - Intergenic
1166129845 19:40739630-40739652 AGGCCTGAGGTTGGCCACGGGGG + Exonic
1168260161 19:55188899-55188921 TGGCTTGGGGTTGGACACTGGGG - Intronic
925246052 2:2384170-2384192 AGGTTTGTGTTTGGATTCTGGGG - Intergenic
925841284 2:7994651-7994673 ATGGCTGTGGCTGGTCTCTGTGG - Intergenic
926741400 2:16114406-16114428 AGGACTGAAATTGGACTCTGGGG + Intergenic
927152940 2:20206024-20206046 AGGCCTGGGGTTGCCCTGTGTGG - Intronic
929087007 2:38178290-38178312 AGTCATGTGGTTGAACCCTGAGG - Intergenic
929679592 2:43977962-43977984 AGGCCTATGGTTAGTATCTGGGG + Intronic
930172831 2:48268749-48268771 AGGCCTGTGGGTGGTTTCTCTGG + Intergenic
931753296 2:65349763-65349785 TGGCCTTTGCTTGCACTCTGAGG + Intronic
933804527 2:85988549-85988571 ATGCCTGGGGTGGGACACTGAGG - Intergenic
934097728 2:88622527-88622549 AGGACTGTGCTTAGACTATGTGG - Intronic
936346562 2:111680014-111680036 AGGCCTGTCGTGGGGCTCAGTGG - Intergenic
936428463 2:112437805-112437827 AGGCCTGTGGTAGCCCTGTGAGG - Intergenic
937978501 2:127596597-127596619 AGGCCTGTGTGGGGACACTGTGG - Intronic
938081534 2:128372962-128372984 AGGGCTGCGGTGGGACCCTGCGG + Intergenic
941861220 2:170282990-170283012 AGTCCTCTGGGTGGACTCAGGGG + Intronic
942494256 2:176522421-176522443 AGGCCTGTGGCTGCTCTTTGAGG - Intergenic
943662257 2:190571678-190571700 AACCCTGTGGTTTGACTCTAGGG - Intergenic
944373198 2:199011002-199011024 AGGCCTGTTGGTGGGGTCTGTGG + Intergenic
947926238 2:233925015-233925037 AGGCCTGTGGCTGGCCTGGGAGG + Intronic
948411488 2:237765914-237765936 AAGCCTGTGGTTCCACTCTTTGG + Intronic
1168853732 20:994287-994309 AGCCCTGGGGGTGGACCCTGGGG - Intronic
1168999438 20:2156780-2156802 AGCCCTGTGGTTAGATTTTGGGG - Intronic
1169022818 20:2342225-2342247 AGGCCTGTCTATGGGCTCTGAGG - Intergenic
1169220924 20:3822298-3822320 AGGCCTGGGGCTGGGCTGTGTGG - Intronic
1172165002 20:32893584-32893606 ATGCCAGTGGTGGGACCCTGGGG + Intronic
1173384099 20:42572450-42572472 TGGCCTGTGGGTGGAAGCTGGGG - Intronic
1173470330 20:43318709-43318731 AGGCCTATGTATGGACACTGGGG - Intergenic
1173479828 20:43390097-43390119 AGCCCTGTAATTGGAGTCTGGGG + Intergenic
1174298149 20:49563254-49563276 AGGCCTGTGGGTGAGCCCTGGGG - Intronic
1177771842 21:25525655-25525677 AGGCCTGTTGATGGACACTTAGG - Intergenic
1178920383 21:36734848-36734870 AGGCCTGGGGTTGGCCCCTCTGG - Intronic
1180663110 22:17486381-17486403 AGGCGTGGGGCTGGACTCCGAGG + Intronic
1181459382 22:23077350-23077372 AAGCATGGGGTTGGACCCTGAGG - Intronic
1181994862 22:26869305-26869327 AGTCCTGTGTGTGGACTCTCAGG + Intergenic
1182342633 22:29636201-29636223 AGACCTGTGATTGGACTGTCTGG + Intronic
1182516722 22:30863180-30863202 AGGCTTGGGGTGGGAGTCTGGGG - Intronic
1184073497 22:42161579-42161601 GGTGCTGGGGTTGGACTCTGAGG + Intronic
1184736013 22:46398208-46398230 ACGTCTGTGGTTGGACTGGGTGG + Intronic
1185203118 22:49520710-49520732 GGGACTGTGGGTGGGCTCTGGGG - Intronic
952902610 3:38120149-38120171 AGGGCTGTGGTTGGGCTCAGAGG - Intronic
952927293 3:38329347-38329369 AGGGCTCTGGTTGGGCTCAGAGG + Intergenic
953605409 3:44410307-44410329 GGGCCTGTGGTTGGGGTCTTTGG - Intergenic
953687989 3:45093319-45093341 AGGCCTCTTGTTGGAAGCTGGGG + Exonic
954508689 3:51102112-51102134 AGGCCTGTGGCTGGTGTCTTTGG + Intronic
955020370 3:55114961-55114983 AGGCATGAGGTGGGCCTCTGGGG + Intergenic
955987448 3:64588652-64588674 AGGAGTGTTATTGGACTCTGAGG - Intronic
956766979 3:72492241-72492263 TGGCCTGTGCATGGACTGTGGGG + Intergenic
962343192 3:134602078-134602100 AGGCCTGTGGAGGGGCTGTGGGG + Intronic
962880928 3:139575753-139575775 GGGCCTGTGGATTGACCCTGGGG + Intronic
966532234 3:180993833-180993855 ACACCTGTGTTTGGAATCTGGGG + Intergenic
966626525 3:182022627-182022649 AGGTCTGTGGGATGACTCTGGGG + Intergenic
967391466 3:188960153-188960175 AGGGCTGTGCATGGATTCTGTGG - Intronic
967956433 3:194880961-194880983 TGGTCTGTGGTGGGACCCTGGGG - Intergenic
968603105 4:1519627-1519649 AGGCCTAGGGGTGGACCCTGCGG + Intergenic
969547738 4:7842854-7842876 GGGCCTGTGGTTTGCGTCTGTGG - Intronic
969687090 4:8681710-8681732 AACCCTGTGCGTGGACTCTGTGG + Intergenic
969691158 4:8704947-8704969 GGGCCTGTGGGAGGAGTCTGTGG + Intergenic
969930028 4:10621812-10621834 TGTCCTGTGATTAGACTCTGGGG + Intronic
973207338 4:47575381-47575403 ATGCCTGTGCCTGGACTCTAGGG + Intronic
978172374 4:105688706-105688728 ACTCCTGAGGTTAGACTCTGAGG + Intronic
978250110 4:106620404-106620426 AGGCCTCTGGCTGCACTCTCTGG + Intergenic
979071531 4:116213799-116213821 AGGCCGGTAGATGGACTCTGAGG - Intergenic
981260502 4:142712950-142712972 AGAGCTGTGTTTTGACTCTGAGG + Intronic
984192253 4:176619922-176619944 AGGCCTTTGGTTGAAATCAGCGG + Intergenic
985868783 5:2537553-2537575 AGGGCTGTGGCTGGATTCTGCGG - Intergenic
987294575 5:16538602-16538624 AGGTCTGTGGTTGCACTGAGAGG - Intronic
990532714 5:56689682-56689704 AAGCCTGCTTTTGGACTCTGTGG - Intergenic
1000179384 5:158793038-158793060 AGCCCTGGGGTTGGACTGTTTGG + Intronic
1001137643 5:169115800-169115822 TCGCCTGTGGTTGGATCCTGTGG + Intronic
1001431589 5:171666828-171666850 AGGTCTGATGTTGGACACTGGGG + Intergenic
1001967067 5:175917757-175917779 AGGCCTGTGACTGGATGCTGAGG - Intergenic
1001974778 5:175988553-175988575 AGGCCTGTGCCTGGATACTGAGG - Intronic
1001997445 5:176173695-176173717 TGCCCTGTGGGTGGACTCTGGGG - Intergenic
1002242656 5:177855225-177855247 AGGCCTGTGCCTGGATACTGAGG + Intergenic
1002249868 5:177921455-177921477 AGGCCTGTGACTGGATGCTGAGG + Intergenic
1002990073 6:2230126-2230148 AATCCTGTGGTAGGACTCTGAGG - Intronic
1003487976 6:6595891-6595913 AGGGCTGTGGGTGGTCCCTGTGG + Intronic
1003563791 6:7205237-7205259 AGGCCTGGGATGGGACTCGGGGG + Intronic
1005711315 6:28505611-28505633 AGGGTTGTGGTTGGACTCCTTGG - Intronic
1005940916 6:30558759-30558781 GGGCCTGTTATTGGACTCTTCGG - Intronic
1006335701 6:33419400-33419422 GGGTCTGTGGTCGCACTCTGAGG + Intergenic
1007174301 6:39885647-39885669 AGGCAGGTGATTGGACTGTGTGG - Intronic
1008351710 6:50499347-50499369 AGCCCTCTGGGTGGACACTGGGG - Intergenic
1008624142 6:53301195-53301217 AGGTCTGTGGTTGGCCTCACTGG + Intronic
1011510020 6:88089929-88089951 AGGCCATTGGTTGGTATCTGTGG - Intergenic
1012288417 6:97421870-97421892 GGGCCTTTGGTAAGACTCTGAGG - Intergenic
1015270570 6:131333863-131333885 AGGACTGTGGTTGGAGGTTGAGG + Intergenic
1017985786 6:159442123-159442145 AGGCATGGGTTTGGATTCTGTGG - Intergenic
1018055849 6:160051609-160051631 AGGCCTGTGGGTGAACGATGAGG + Intronic
1018350720 6:162956230-162956252 AAGTCTGTGGCTGGTCTCTGGGG - Intronic
1018903192 6:168061325-168061347 AGGCCTGTGGGTAAACGCTGAGG + Intronic
1018903223 6:168061461-168061483 AGGCCTGTGGGTAAACACTGAGG + Intronic
1019106097 6:169668116-169668138 AGGTCGGTGGTGGGACTTTGTGG + Exonic
1019190874 6:170249940-170249962 AGGACTGTGGTTGGAGGGTGTGG + Intergenic
1019564051 7:1670909-1670931 CCGCCAGTGGTTGGACTCAGGGG - Intergenic
1019774760 7:2905978-2906000 AGGCCTGTCCTGGGACCCTGGGG + Intergenic
1020915524 7:14187496-14187518 AGGCTGGTTGTTGGACTCTGTGG - Intronic
1023613617 7:41996051-41996073 GGGCCTGTGGTTCAACTCTCAGG + Intronic
1024058675 7:45682516-45682538 AGGCCCTTGGCTGGACCCTGGGG + Intronic
1024446331 7:49483900-49483922 AGGCTTGAAGTGGGACTCTGAGG - Intergenic
1026561499 7:71454224-71454246 GGGCCTGTTGGTGGAGTCTGGGG - Intronic
1030670083 7:112325986-112326008 AGGCCAGTGGTTGGCTCCTGGGG - Intronic
1031894323 7:127330803-127330825 AGGCCTGTACCTGAACTCTGAGG + Intergenic
1033047604 7:137976862-137976884 AGGCCAGTGGGTGGAGCCTGTGG + Intronic
1033673829 7:143518650-143518672 AGGCCCGAGGCTGGGCTCTGAGG + Intergenic
1034464163 7:151215940-151215962 AGGCCTGGGGTTGGGATCCGGGG - Intronic
1035101076 7:156397069-156397091 AGGGCTGTTGTCGGAGTCTGGGG - Intergenic
1035294719 7:157860348-157860370 AAGGCTGTGGGTGGACTGTGGGG - Intronic
1035776879 8:2194822-2194844 AGGTCTGTGTTTTGACTCCGTGG - Intergenic
1037083434 8:14816623-14816645 AGTTCAGTTGTTGGACTCTGAGG + Intronic
1037709627 8:21345329-21345351 GGGCCTGAAGTTGAACTCTGAGG + Intergenic
1037892435 8:22630370-22630392 GGGCCTCTGGGTGGACTGTGCGG - Intronic
1038189750 8:25309053-25309075 AAGCCTGTGGTTGGAAGCTGAGG - Intronic
1038269282 8:26062160-26062182 AGGCCTGTGGTTGGACCTAATGG - Intergenic
1038398158 8:27262212-27262234 AGGCCTGGATTTGAACTCTGGGG + Intergenic
1039371040 8:36984190-36984212 CGGCCTGTTCTTGGTCTCTGGGG - Intergenic
1045265771 8:100617502-100617524 TGGCCTGTTGTTTTACTCTGTGG - Intronic
1045370292 8:101516030-101516052 AACCCTGTGGTCTGACTCTGTGG + Intronic
1048015958 8:130498283-130498305 AGGCATGAGGTTGGAATGTGGGG - Intergenic
1048548968 8:135415923-135415945 AGCCTTGTGGTTGGAGTTTGGGG + Intergenic
1049025486 8:139985500-139985522 AGGGCTGTGGCTGGATGCTGCGG - Intronic
1049731089 8:144178921-144178943 AGGCAGGTGGTTGGACTCTGCGG + Intronic
1049749326 8:144275934-144275956 TGGCCTGTGGACGGGCTCTGGGG - Intronic
1051788459 9:20772397-20772419 GGGCTTGTGGTGGAACTCTGGGG + Intronic
1052467451 9:28847204-28847226 AGGCCTGTGATTGGAGTCTTAGG - Intergenic
1053025471 9:34725242-34725264 TGGCCTGGGGATGGACACTGGGG + Exonic
1053037000 9:34834304-34834326 TGGCCTGGGGATGGACACTGGGG + Intergenic
1061135726 9:128732184-128732206 AGGCCTGTGATGGGAATCTGAGG - Intronic
1061159645 9:128885896-128885918 AGGCCCTTGGCTGGGCTCTGGGG - Intronic
1062702165 9:137913001-137913023 GGCCCTGTGGTTGGACAGTGGGG + Intronic
1062702176 9:137913037-137913059 GGCCCTGTGGTTGGACAGTGGGG + Intronic
1185754250 X:2640724-2640746 AGGCCTCTGCTAGAACTCTGGGG + Intergenic
1186367810 X:8913686-8913708 AGGATTTTGGTTGGACACTGGGG + Intergenic
1186487724 X:9946437-9946459 AGGCCTGTGGGCGGCTTCTGGGG + Intronic
1187390240 X:18882038-18882060 AAGCCGGAGGTTGCACTCTGAGG - Intergenic
1189164253 X:38844582-38844604 AGGCCAGTGGTTAGCCTCTCTGG - Intergenic
1189257974 X:39654880-39654902 GAGCCTGGGCTTGGACTCTGGGG - Intergenic
1190913704 X:54794432-54794454 AGGCGTGGGTTTGGACTATGGGG - Intronic
1192080158 X:68040027-68040049 AGGCCTGTGGTTGTTATCTGGGG - Intergenic
1193534802 X:82700709-82700731 AGCGCTGTGTTTGGACTTTGTGG + Intergenic
1196564483 X:117189000-117189022 GGGCCTTTGGTTAGACTCTGAGG + Intergenic
1196749292 X:119100358-119100380 AATCCTGTGGTTGGCTTCTGTGG - Intronic
1198281692 X:135149048-135149070 AAGCCTGAGGTTTGACTGTGAGG - Intergenic
1198289267 X:135223474-135223496 AAGCCTGAGGTTTGACTGTGAGG + Intergenic
1201392310 Y:13512403-13512425 AGGCCTAGTGTTGGAGTCTGAGG - Intergenic
1201642508 Y:16194588-16194610 AGGCCTGTGGGTGCACTAGGAGG - Intergenic
1201660306 Y:16390732-16390754 AGGCCTGTGGGTGCACTAGGAGG + Intergenic
1202369223 Y:24185996-24186018 AGGCCTGTGGCTGGTCTGTGGGG + Intergenic
1202501562 Y:25484121-25484143 AGGCCTGTGGCTGGTCTGTGGGG - Intergenic