ID: 1142149986

View in Genome Browser
Species Human (GRCh38)
Location 16:88508484-88508506
Sequence TGGAGCCCAAGGCCTGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142149986_1142149993 2 Left 1142149986 16:88508484-88508506 CCAACCACAGGCCTTGGGCTCCA No data
Right 1142149993 16:88508509-88508531 TGGGTTCCCCTGGTCTCTCCTGG 0: 1
1: 0
2: 1
3: 36
4: 239
1142149986_1142149997 9 Left 1142149986 16:88508484-88508506 CCAACCACAGGCCTTGGGCTCCA No data
Right 1142149997 16:88508516-88508538 CCCTGGTCTCTCCTGGGCACAGG 0: 1
1: 1
2: 4
3: 68
4: 590
1142149986_1142149991 -8 Left 1142149986 16:88508484-88508506 CCAACCACAGGCCTTGGGCTCCA No data
Right 1142149991 16:88508499-88508521 GGGCTCCACGTGGGTTCCCCTGG 0: 1
1: 0
2: 3
3: 11
4: 145
1142149986_1142149994 3 Left 1142149986 16:88508484-88508506 CCAACCACAGGCCTTGGGCTCCA No data
Right 1142149994 16:88508510-88508532 GGGTTCCCCTGGTCTCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142149986 Original CRISPR TGGAGCCCAAGGCCTGTGGT TGG (reversed) Intronic
No off target data available for this crispr