ID: 1142149987

View in Genome Browser
Species Human (GRCh38)
Location 16:88508488-88508510
Sequence CACGTGGAGCCCAAGGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 5, 3: 16, 4: 252}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142149987_1142149994 -1 Left 1142149987 16:88508488-88508510 CCACAGGCCTTGGGCTCCACGTG 0: 1
1: 0
2: 5
3: 16
4: 252
Right 1142149994 16:88508510-88508532 GGGTTCCCCTGGTCTCTCCTGGG No data
1142149987_1142149997 5 Left 1142149987 16:88508488-88508510 CCACAGGCCTTGGGCTCCACGTG 0: 1
1: 0
2: 5
3: 16
4: 252
Right 1142149997 16:88508516-88508538 CCCTGGTCTCTCCTGGGCACAGG 0: 1
1: 1
2: 4
3: 68
4: 590
1142149987_1142149993 -2 Left 1142149987 16:88508488-88508510 CCACAGGCCTTGGGCTCCACGTG 0: 1
1: 0
2: 5
3: 16
4: 252
Right 1142149993 16:88508509-88508531 TGGGTTCCCCTGGTCTCTCCTGG 0: 1
1: 0
2: 1
3: 36
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142149987 Original CRISPR CACGTGGAGCCCAAGGCCTG TGG (reversed) Intronic
900378846 1:2373751-2373773 CACGAGGAGCCCGGGGCCAGCGG + Intronic
900943335 1:5815239-5815261 CACATGGAACCCATGCCCTGGGG - Intergenic
900975084 1:6011786-6011808 CACCTGGAGCCCAGGGCAGGGGG + Intronic
901191113 1:7410299-7410321 GACATGGGGCCCAGGGCCTGCGG + Intronic
901250110 1:7771500-7771522 CGCGGGGATCCCGAGGCCTGGGG + Intronic
902274456 1:15329306-15329328 CATGAGGAGCCCAGGCCCTGTGG - Intronic
902288482 1:15421744-15421766 CACGTGGGACCCAGGGGCTGGGG + Intronic
903550642 1:24155585-24155607 CAACTGCAGCCCAAGGCCTCTGG + Exonic
903951869 1:27000352-27000374 CACGTGGAGAACAAGGGCAGTGG - Exonic
905022170 1:34825528-34825550 CAACTGGAGCCCACGGACTGGGG + Intronic
905364444 1:37441660-37441682 CACGTGGTACCCGTGGCCTGGGG - Intergenic
905645686 1:39623695-39623717 AACGTTGAAGCCAAGGCCTGAGG + Intergenic
905846945 1:41241738-41241760 CACGGGAAACCCAAGGCCGGGGG - Intronic
909402980 1:75254983-75255005 CACGTGGAGCCCATGACCTGTGG + Intronic
909941963 1:81621499-81621521 CAAGTGGTGCCTAAGGCCTCAGG + Intronic
910602951 1:89050854-89050876 AACATGGTGCCCAGGGCCTGGGG + Intergenic
912138859 1:106696725-106696747 CACCTGAATCCCAGGGCCTGTGG + Intergenic
912152748 1:106880105-106880127 CATCTGGAGCCCAAGGCGTATGG - Intergenic
912418586 1:109528605-109528627 AACTTGGAGCCGAAGCCCTGTGG + Intergenic
912625132 1:111200062-111200084 CACATGGAGGCCAAGGCCCCAGG + Intronic
915030929 1:152879870-152879892 CACCTGGAGCCCAGGTCCAGGGG - Intronic
915444403 1:155966662-155966684 TACTTGGGGCCCGAGGCCTGGGG + Intronic
916755652 1:167767724-167767746 CATGTGGATCCCAAGGCCATGGG - Intronic
922473604 1:225891033-225891055 CACATGGGCCCCCAGGCCTGGGG - Intronic
922763331 1:228145512-228145534 CATGTCGGGCCCCAGGCCTGTGG + Exonic
922771410 1:228185663-228185685 CACGTGGTGCTCACGGCCTGGGG + Intergenic
1062961664 10:1577094-1577116 CTTGTAGAGCCCTAGGCCTGGGG + Intronic
1065699799 10:28413919-28413941 CAGGTGGAGCACAAGGTCAGGGG + Intergenic
1067179632 10:43974762-43974784 AAGCTGTAGCCCAAGGCCTGGGG - Intergenic
1067281104 10:44873778-44873800 GACGTGGAAACCGAGGCCTGAGG - Intergenic
1067295388 10:44972617-44972639 CAAGTGGAGCCCTAGTCTTGCGG + Intronic
1068985101 10:63100959-63100981 CACTGGGAGGCCAAGGCCGGAGG + Intergenic
1069923797 10:71834095-71834117 CACCTGGAGCCGCAGGCATGGGG + Intronic
1070500442 10:77067593-77067615 CAAGTGGAGCTGAAGGGCTGGGG - Intronic
1072543881 10:96419340-96419362 CACAAGGAAACCAAGGCCTGTGG + Intronic
1075085173 10:119409906-119409928 CACATGGAGCCCAGGCCCTGAGG - Intronic
1075723853 10:124601882-124601904 CACGTGGAGCACCAGCCATGGGG + Intronic
1075727947 10:124620272-124620294 CCCGTGGGGCCCAGGGGCTGGGG - Exonic
1076081470 10:127585379-127585401 CTCCTGGAGCTCAGGGCCTGGGG + Intergenic
1076619643 10:131778998-131779020 CAGGAAGGGCCCAAGGCCTGTGG + Intergenic
1076717751 10:132374965-132374987 CACGTGGGGCCCAGGCCATGTGG - Intronic
1077364253 11:2155178-2155200 CTCGAGGAGGCCAAGCCCTGGGG - Intronic
1077443783 11:2580864-2580886 CACGTGCAGCCCGAGACTTGAGG - Intronic
1079492472 11:21004535-21004557 CCTGTGGAGACCAAGGCATGTGG - Intronic
1079572578 11:21962799-21962821 TACTTGGAGCCCAAGGCAAGAGG + Intergenic
1081870001 11:46379121-46379143 GCAGTGGAGCCCAGGGCCTGGGG + Intronic
1082645833 11:55723772-55723794 CACGAGGTCCCCAAGGCCTTGGG + Intergenic
1083774525 11:64887990-64888012 CGCGCGGCTCCCAAGGCCTGGGG - Intronic
1084109855 11:67007130-67007152 CAAGTTGAGGCCAAGACCTGGGG + Exonic
1084155532 11:67310794-67310816 CCTGTGGAGCTCATGGCCTGGGG - Intronic
1084485442 11:69445187-69445209 GACGCGGACACCAAGGCCTGGGG + Intergenic
1084493561 11:69491071-69491093 CTCTTGGAGGTCAAGGCCTGGGG - Intergenic
1084527124 11:69704378-69704400 CACTGGGAGCCTGAGGCCTGGGG - Exonic
1084603432 11:70159735-70159757 CAGCTGGAGCGCCAGGCCTGTGG - Intronic
1087007170 11:93481855-93481877 CAGGTGGCACCCCAGGCCTGGGG + Intronic
1088102631 11:106171935-106171957 AACTTGGAGCCCAATACCTGAGG - Intergenic
1090234716 11:125139121-125139143 CACGTGGAGGCCCTGGCCTCAGG + Intergenic
1090234738 11:125139192-125139214 CACGTGGAGGCCCTGGCCTCAGG + Intergenic
1091201677 11:133785264-133785286 CACGTGGAGCCCAGGGCAGCAGG - Intergenic
1091684194 12:2550043-2550065 CACGGCGAGCCCAGGGGCTGGGG + Intronic
1092040039 12:5375978-5376000 CACTGGGAGGCCAAGGCCGGTGG + Intergenic
1093203715 12:16221566-16221588 CACGTGGAGACCAAATCATGTGG + Intronic
1096182900 12:49560195-49560217 CAACGGGAGCCCAAGGGCTGGGG + Intronic
1096241734 12:49963365-49963387 CACCTGGAAGCCAAGTCCTGTGG - Intronic
1096379034 12:51139730-51139752 CAGGTGGACCCCAAGGCCTGGGG - Intronic
1096612000 12:52808253-52808275 CAGATGGAGCACAAGGCCAGGGG - Intronic
1097270664 12:57772114-57772136 CACGTGGAGGCGCAGGCCAGAGG + Exonic
1098319892 12:69232479-69232501 CAAGGGGTGCCCAAGGCCTTGGG - Intergenic
1102733139 12:115132297-115132319 CAGCTGGAGACAAAGGCCTGAGG - Intergenic
1103699743 12:122842925-122842947 CAGGGGGAGCCCAAGCCCTCAGG - Intronic
1103700321 12:122845813-122845835 CATCTGGAGCCTAGGGCCTGGGG + Intronic
1104875912 12:132034710-132034732 CTCGTGGAGCACAAGGTGTGCGG - Intronic
1105998320 13:25694243-25694265 AATGTGGAGCCCATTGCCTGTGG - Intronic
1106379527 13:29223138-29223160 CAGGGATAGCCCAAGGCCTGGGG + Intronic
1106435603 13:29720855-29720877 GCCCTGGATCCCAAGGCCTGGGG + Intergenic
1106993424 13:35451261-35451283 GGCGTGGAGCCAAAAGCCTGTGG - Intronic
1119092825 14:71800669-71800691 CATTTGGAGCCAAAGGCCAGAGG + Intergenic
1119191523 14:72685866-72685888 CACGTGGAGCCCCAATCCTAGGG + Intronic
1119201326 14:72755050-72755072 GAAGTGGAGGCCCAGGCCTGAGG + Intronic
1119440867 14:74627971-74627993 GATGAGGAGCCCAAGGCCAGGGG - Intergenic
1122627641 14:103092383-103092405 CTGGTGGTGCCCAGGGCCTGGGG - Intergenic
1122885782 14:104709727-104709749 CACCTGGGGCCCAGGCCCTGGGG - Intronic
1123135375 14:106022791-106022813 CACATGGTGCCCAGGACCTGTGG + Intergenic
1123207107 14:106724185-106724207 CACGTGGACCCCCACACCTGAGG - Intergenic
1123212127 14:106771188-106771210 CACGTGGACCCCCACACCTGAGG - Intergenic
1202894973 14_GL000194v1_random:1687-1709 CACATGGGACCCAGGGCCTGTGG + Intergenic
1123585919 15:21760653-21760675 CACATGGTGCCCAGGACCTGTGG + Intergenic
1123622560 15:22203243-22203265 CACATGGTGCCCAGGACCTGTGG + Intergenic
1125831004 15:42717139-42717161 GATGAGGAGCCCAAGGCTTGTGG + Intronic
1125910775 15:43436724-43436746 CACTTGGAGGCCAAAGCATGAGG - Intronic
1128544832 15:68559852-68559874 CACGGAGAGCACAAGGCGTGTGG + Intergenic
1129460494 15:75697988-75698010 CACATACAGACCAAGGCCTGAGG + Intronic
1129724369 15:77894048-77894070 CACATACAGACCAAGGCCTGAGG - Intergenic
1129995932 15:80006251-80006273 CACTGGGTGCCAAAGGCCTGTGG + Intergenic
1132351309 15:101141396-101141418 CACACGGAGCCCTAGGCCTCTGG - Intergenic
1132584702 16:701047-701069 CACGTGGAGCGCCGGGGCTGGGG + Intronic
1132891755 16:2208167-2208189 CACGGAGGGCCCAAGGCCTCAGG - Intronic
1133021125 16:2967411-2967433 CCGGCGGAGCCCCAGGCCTGGGG - Exonic
1133678284 16:8096515-8096537 CACCTGGAGCCAAAAGCTTGTGG + Intergenic
1133878905 16:9762464-9762486 CATCTGGAGCCAAAGGCCCGAGG - Exonic
1134456661 16:14400202-14400224 CACGTTCAGCCCGGGGCCTGTGG - Intergenic
1136458939 16:30398139-30398161 CACTTGGGGCCCAAGCCCTTTGG + Exonic
1137655876 16:50157700-50157722 CACTGGGAGGCCAAGGCATGTGG - Intronic
1138271990 16:55702097-55702119 CACCTTGAGCCCATGGCCTCAGG + Intronic
1139486878 16:67262793-67262815 CAGGTGGTGCCTCAGGCCTGGGG + Intronic
1140496403 16:75393068-75393090 CACGTGCAGCTCACAGCCTGAGG + Intronic
1141132574 16:81445621-81445643 CACCTGGAGCCCAGGGCCTGGGG + Intronic
1142142260 16:88477933-88477955 CTCCTGGAGCCCACAGCCTGAGG + Intronic
1142149987 16:88508488-88508510 CACGTGGAGCCCAAGGCCTGTGG - Intronic
1142349054 16:89571420-89571442 GACCAGGAGCCCAAGTCCTGGGG + Intergenic
1142799848 17:2338003-2338025 CGCTGGGAGCCCAAGGCCGGGGG + Intronic
1144149690 17:12431263-12431285 AACGTGGAGCCCAGGAGCTGAGG - Intergenic
1145116367 17:20214123-20214145 CACATGGAACCCACGCCCTGCGG + Intronic
1146949617 17:36896844-36896866 GACCTGGAGCCCAAGCCCAGGGG - Intergenic
1147594159 17:41706000-41706022 CACATGGAGTCCAAGACCCGGGG + Intergenic
1147725108 17:42562192-42562214 CAAGTGGAACCCAAGCCTTGAGG + Exonic
1148682608 17:49483309-49483331 CCTGTGGAGCCCAAGGCCTGGGG - Intergenic
1152377631 17:79926900-79926922 CACTGGGAGCTCAAGGCCAGTGG - Intergenic
1152567142 17:81105335-81105357 CACGTCCAGCCGAAGCCCTGTGG + Intronic
1154300951 18:13192065-13192087 AGCGAGAAGCCCAAGGCCTGTGG + Intergenic
1155520271 18:26660985-26661007 CAGGTTGAGCCCAAGCACTGAGG - Intergenic
1157684467 18:49631248-49631270 CACATGGGGTCAAAGGCCTGGGG - Intergenic
1159867549 18:73724158-73724180 CACGTGCAGCCCAAGGAGAGAGG + Intergenic
1162234378 19:9295754-9295776 CATGTGGATCCTAAGGGCTGAGG + Exonic
1162902153 19:13801494-13801516 CACGTGGGCCCCACTGCCTGAGG - Intronic
1163774263 19:19208561-19208583 CAGGTGGAAGCCAAGGTCTGTGG - Intergenic
1163787047 19:19280048-19280070 CAGGTGGAACCCATGGCCAGCGG - Intronic
1163821878 19:19500621-19500643 TGGGTGCAGCCCAAGGCCTGGGG + Intronic
1165158646 19:33803117-33803139 CACCTTGAGCCCCAGCCCTGGGG - Intronic
1165549604 19:36573171-36573193 CACGTGGAGCCGGGAGCCTGAGG - Exonic
1165770035 19:38374689-38374711 GAGGTGGAGCCCAAGGCCCGGGG - Exonic
1167290251 19:48620678-48620700 CTCTGGGAGGCCAAGGCCTGCGG + Intronic
1168631200 19:57957679-57957701 CAAGTGGACACCAAGGGCTGTGG - Intergenic
925402945 2:3588666-3588688 CACATGCAGCCCCAGGGCTGTGG - Intergenic
929083686 2:38147123-38147145 CAAGGGGGGCCCAAGGCCTCAGG - Intergenic
930056905 2:47259154-47259176 CAATGGGAGCCCAATGCCTGTGG - Intergenic
937152357 2:119694726-119694748 CACCGGGGGCCCAAGGTCTGGGG - Intergenic
937262852 2:120597478-120597500 CCCTGGGAGCCCCAGGCCTGTGG - Intergenic
937332700 2:121042260-121042282 AAAGAGGAGCCCAAGGTCTGCGG + Intergenic
937625986 2:124044602-124044624 AAGGTGGAACCCAAGACCTGTGG - Intronic
937931057 2:127205484-127205506 CACGTGGCGACCAAGGCTGGAGG + Intronic
938466739 2:131529891-131529913 CTCGGGAAGCCCAGGGCCTGAGG + Intronic
945213207 2:207405459-207405481 CACGCTGAGCTCAGGGCCTGAGG - Intergenic
948327230 2:237134541-237134563 CAACTGCAGCCCCAGGCCTGAGG - Intergenic
948447764 2:238046347-238046369 CAGGTGGAGCCCAGTGACTGTGG + Intronic
948900936 2:240956612-240956634 CCCCTGGAGCCCAAGTCCAGGGG + Intronic
1169355661 20:4902828-4902850 CAGGAGGATCCCCAGGCCTGGGG - Intronic
1170783700 20:19449394-19449416 CACGTGGCGCCCAAGCTCTGGGG + Intronic
1170937815 20:20825013-20825035 CACGTGGAGGCCCAGGGCTGGGG + Intergenic
1171376852 20:24699783-24699805 CAGGTGGAGCCCAGAGACTGGGG + Intergenic
1172183703 20:33018833-33018855 GACCTGCAGCCCAGGGCCTGTGG + Intronic
1172898564 20:38317524-38317546 TACGAGAAGCCCAAGCCCTGTGG - Intronic
1173513403 20:43648104-43648126 CACATGCAGCCCATGGGCTGCGG - Intergenic
1174005305 20:47406118-47406140 CACTTGGAGGCCAAGGCCAGAGG - Intergenic
1174111726 20:48201994-48202016 CACTTGGTGGCCAAGGCCTGGGG + Intergenic
1175283968 20:57824928-57824950 CAGGGGGAGCCCAGGGACTGAGG - Intergenic
1175894183 20:62328814-62328836 CACTGGGCGCCCAAGGACTGGGG + Intronic
1176614678 21:9017674-9017696 CACATGGGACCCAGGGCCTGTGG + Intergenic
1179497671 21:41784044-41784066 CAGGGGCAGCCCAAGACCTGCGG + Intergenic
1179640685 21:42745619-42745641 CACGTAGAGCCCACGGCCAAGGG - Intronic
1179818318 21:43922159-43922181 CATGTGGAGGCCCAGGCTTGTGG + Intronic
1179902556 21:44401602-44401624 CACGGGGTGGCCAAAGCCTGTGG + Intronic
1180188305 21:46151150-46151172 GACGTGGAGGGAAAGGCCTGGGG + Intronic
1180197046 21:46203163-46203185 CAGGTGGACCCCAAGCCATGTGG + Intronic
1180728633 22:17964542-17964564 CACGTAGGGTCCAAGTCCTGTGG - Intronic
1183708554 22:39489349-39489371 CACACGGAGCCCAAGGCCCAGGG - Exonic
1185417795 22:50719842-50719864 CCCGTGCAGCCCTGGGCCTGGGG + Intergenic
949978278 3:9480752-9480774 CACGTGCAGCCCGTGGTCTGTGG + Intergenic
950085411 3:10254134-10254156 CACGTGGAACACCAGGCTTGGGG + Intronic
950675416 3:14551427-14551449 AGAGTGGAGCCCAGGGCCTGGGG - Intergenic
953283714 3:41583662-41583684 CATGAGGAGGCCATGGCCTGAGG - Intronic
953391033 3:42533867-42533889 GAAGTCTAGCCCAAGGCCTGAGG - Intronic
954584243 3:51720165-51720187 CAGGGAGAGCCAAAGGCCTGGGG + Intergenic
957520671 3:81314268-81314290 CACGTGAAACCCAAGGACAGTGG + Intergenic
961196019 3:125002054-125002076 CACGTGGGTCCCAAGGCTTTTGG + Intronic
961252866 3:125521410-125521432 CACTGGGAGGCCAAGGCCGGCGG + Intergenic
961546825 3:127640123-127640145 AACCTGGAGCCCTAGGCCTCGGG - Intronic
961658836 3:128457719-128457741 CAGGTGGGGACCCAGGCCTGTGG - Intergenic
961786411 3:129349775-129349797 CACGTGGATGCCGAGGCCTGAGG - Intergenic
961942974 3:130656600-130656622 CAGGGGGAGCCCGAAGCCTGGGG - Intronic
962431715 3:135326334-135326356 CTTGTGGAGCTGAAGGCCTGTGG - Intergenic
962961108 3:140311817-140311839 CACCTGGAGCCCAGGATCTGGGG - Intronic
967284388 3:187854123-187854145 CTCATGGAGCCCACAGCCTGGGG + Intergenic
967621653 3:191641850-191641872 CACATGAAGCCCAAGGGCTTTGG + Intergenic
968093235 3:195910456-195910478 CGCGTGGAGCCCAAGGGCTCAGG + Intronic
968476108 4:809540-809562 CATGTGGCCCCCACGGCCTGAGG - Intronic
968489266 4:881318-881340 CTCATGGAGACCAAGGCCAGGGG + Intronic
968905019 4:3446999-3447021 CACATGGAGCCCAGGGCAGGAGG + Intronic
968918627 4:3510799-3510821 CACGTGGAACCCATGGCAGGCGG + Exonic
969013394 4:4085887-4085909 CTTTGGGAGCCCAAGGCCTGTGG + Intergenic
969194619 4:5550914-5550936 CACGTGGCTGCCAAGGCTTGGGG - Intronic
969642497 4:8407397-8407419 CACATGGGGCCACAGGCCTGGGG + Intronic
969726716 4:8922517-8922539 CACCTGGAGCCCTTGGCCTATGG - Intergenic
970378184 4:15479741-15479763 GCCGTGCAGCCCAAGGCCAGGGG + Intronic
975420515 4:74158356-74158378 CGCGTGGGGCCCAAGGCTCGTGG + Intronic
978083673 4:104623786-104623808 CACATGCAGCCCATGGGCTGCGG + Intergenic
978344856 4:107756459-107756481 CACGTGGAAGCCAAGGCTTAAGG - Intergenic
981019401 4:140009285-140009307 CCTGTGCAGCACAAGGCCTGTGG - Intronic
984992725 4:185396662-185396684 CACGTGGAGCCCGGCGCCGGGGG - Exonic
986280695 5:6319712-6319734 CACCTGGAGCCCAATCACTGGGG - Intergenic
991579596 5:68140516-68140538 GACCTGTAGCCCAAGGCATGAGG - Intergenic
992621936 5:78602678-78602700 CACCTAGAGCCCAAGGCCTTGGG + Intronic
992888845 5:81185467-81185489 CACTGGCAGCCCAGGGCCTGGGG + Intronic
996006786 5:118430462-118430484 CACCTGGAGGCCAAGGTCAGAGG + Intergenic
998153844 5:139772847-139772869 CACCTGGAGCTCACAGCCTGCGG - Intergenic
998705860 5:144759306-144759328 CATGAGGAGATCAAGGCCTGGGG + Intergenic
1001546948 5:172576128-172576150 CACGTGGGGGCCACGGCCTAGGG - Intergenic
1001734840 5:173989364-173989386 GCCGTGGAGCTCAAGGCCTTTGG + Exonic
1001875089 5:175193221-175193243 CCCGTGGAGCCTGGGGCCTGTGG - Intergenic
1002293319 5:178214253-178214275 CACTTGGACCCCAAGTCCTCAGG - Intronic
1003343033 6:5239999-5240021 CAGGTGGAACCCAGGGCCTGTGG + Intronic
1003531674 6:6942230-6942252 CATCTGGGGCCAAAGGCCTGGGG - Intergenic
1003905451 6:10695037-10695059 CACCCGGAGCCCGAGGCTTGCGG + Exonic
1005927273 6:30453847-30453869 CCCGTGTGGCCCAAGGACTGAGG - Intergenic
1006077803 6:31545565-31545587 CCCTGGGAGCCCATGGCCTGGGG + Exonic
1006854002 6:37120078-37120100 CACCTGGAGTTGAAGGCCTGAGG - Intergenic
1007284890 6:40740563-40740585 CAGGAGGAGCCCAAGGCCTCTGG + Intergenic
1007429914 6:41770821-41770843 CAGGTGGAGCTAAAGGGCTGGGG - Exonic
1007605711 6:43116381-43116403 CACGAGCCGCCCAGGGCCTGTGG - Intronic
1013989612 6:116238291-116238313 CACGAGGAGTCAGAGGCCTGAGG + Exonic
1018957433 6:168419632-168419654 GGCCTGGGGCCCAAGGCCTGAGG + Intergenic
1019083983 6:169456987-169457009 CACGTGGAACCCATGGGCAGAGG + Intergenic
1019475605 7:1242702-1242724 CACGCGGAGCCCGCGGCCAGTGG - Intergenic
1019610935 7:1936279-1936301 CCCTTTGAGGCCAAGGCCTGTGG - Intronic
1019625422 7:2013497-2013519 CACGAGGAAACCCAGGCCTGGGG - Intronic
1020046595 7:5045549-5045571 GTCCTGGAGCCCAAGGCCTCTGG - Intronic
1020070362 7:5223312-5223334 GACGTGGAGCCACAGACCTGAGG - Intronic
1021913095 7:25405814-25405836 GAAGTGAAGCCCAGGGCCTGTGG - Intergenic
1023295738 7:38713592-38713614 CACGTGGAGCCAAACTCCTATGG + Intergenic
1023859993 7:44212806-44212828 CACTTCAGGCCCAAGGCCTGGGG + Exonic
1023994306 7:45149789-45149811 CAGCTGCAGCCCCAGGCCTGAGG + Intergenic
1024725680 7:52191271-52191293 CACGTGTAGCCCATGGGCTGTGG - Intergenic
1025244157 7:57303610-57303632 CACTTTGAGGCCAAGGCGTGTGG - Intergenic
1027895761 7:84042406-84042428 CACATGGATCCCAAGGCCTGGGG - Intronic
1029246518 7:99205959-99205981 CAGGTTGAGCCCAAGGGCTGGGG - Intronic
1029246817 7:99208008-99208030 CAGGTTGAGCCCAAGGGTTGGGG - Intergenic
1029272597 7:99385872-99385894 CACATGGAGCCCATGGTCCGGGG - Intronic
1032455807 7:132072673-132072695 CATGAGGAGCCCAAGGGATGGGG - Intergenic
1032871179 7:135987618-135987640 CACATGCAGCCCAGGGGCTGTGG + Intergenic
1034154711 7:148946941-148946963 AACTTGGAGCCCAAGGCAGGAGG - Intergenic
1035029528 7:155848414-155848436 CACTAAGAGCCCCAGGCCTGGGG - Intergenic
1035036531 7:155898998-155899020 GACATGGTGCCCAAGGTCTGGGG + Intergenic
1035355423 7:158273609-158273631 CACGGGGAGCCGCAGGCATGGGG + Intronic
1035577785 8:719077-719099 CACCGGGAGCCCAGGCCCTGGGG + Intronic
1036926033 8:12906916-12906938 CAGGTGGAGGCCAAGGCAGGTGG + Intergenic
1037758607 8:21727400-21727422 CACACAGGGCCCAAGGCCTGGGG - Intronic
1037974498 8:23200030-23200052 CATGTGGATCCCCAGGCCCGGGG - Intronic
1043030730 8:75130797-75130819 CATGTGGAAGCCAAGGCTTGGGG - Intergenic
1044329577 8:90900820-90900842 CACTTTGAGCCCCAGGCTTGGGG - Intronic
1044430668 8:92103128-92103150 CACGCAGAGCCCAAGACTTGCGG + Intronic
1047477453 8:125247479-125247501 CTTGGGGAGCCCAAGGCCGGTGG + Intronic
1048833655 8:138498319-138498341 CACTTGGATCGCAAGGCCTTTGG - Intergenic
1051663040 9:19443407-19443429 CTCTTGGAGGCCAAGGCCGGGGG - Intronic
1053396093 9:37775778-37775800 CACTTTGAGGCCAAGGCCAGAGG - Intronic
1057599456 9:96444653-96444675 CTCTCGGAGCCCAAGGCATGAGG - Intergenic
1058072998 9:100620137-100620159 CACATGCAGCCCATGGGCTGTGG + Intergenic
1058849406 9:108996205-108996227 CACTTGGAGGCCAAGGCGGGTGG - Intronic
1060807563 9:126587200-126587222 CACGATGAGCCCAAGGTCTTGGG + Intergenic
1061328740 9:129879466-129879488 CACGCTGACCCCCAGGCCTGGGG + Intronic
1061888413 9:133605069-133605091 CAGGTGCAGACCGAGGCCTGTGG + Intergenic
1061965005 9:134008452-134008474 CACCTGGAGGGCAAGGCCTGGGG - Intergenic
1062510470 9:136902525-136902547 CGCGTGGCGCCCCAGGCCAGGGG - Intronic
1185787070 X:2899819-2899841 GACGTGGAGGCCAAGGACAGAGG + Intergenic
1187441836 X:19327840-19327862 CAGGAGGAGCCCACTGCCTGTGG - Intergenic
1187993038 X:24896350-24896372 CACATGCAGCCCATGGGCTGTGG - Intronic
1188820920 X:34774131-34774153 CAAGTGGAACCTAAAGCCTGTGG - Intergenic
1190827391 X:54029901-54029923 CACATGGTGCCCCATGCCTGAGG - Intronic
1191608298 X:63084779-63084801 TATGTGTAGCCCAAGGGCTGGGG - Intergenic
1192244805 X:69363325-69363347 CACTTGGAGCCCATGGACTTGGG - Intergenic
1192807893 X:74525820-74525842 CACAAGACGCCCAAGGCCTGAGG - Exonic
1192946253 X:75967734-75967756 CACGTGGAGCTGCAGCCCTGTGG + Intergenic
1195688181 X:107603746-107603768 CACGAGGAGCTCAAAGCCTGAGG - Exonic
1201276463 Y:12303305-12303327 CACGTGCAGCCCGTGGGCTGTGG - Intergenic
1201287315 Y:12390216-12390238 GACGTGGAGGCCAAGGACAGAGG - Intergenic