ID: 1142149990

View in Genome Browser
Species Human (GRCh38)
Location 16:88508495-88508517
Sequence GGGAACCCACGTGGAGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142149990_1142149997 -2 Left 1142149990 16:88508495-88508517 CCTTGGGCTCCACGTGGGTTCCC 0: 1
1: 0
2: 4
3: 13
4: 141
Right 1142149997 16:88508516-88508538 CCCTGGTCTCTCCTGGGCACAGG 0: 1
1: 1
2: 4
3: 68
4: 590
1142149990_1142149994 -8 Left 1142149990 16:88508495-88508517 CCTTGGGCTCCACGTGGGTTCCC 0: 1
1: 0
2: 4
3: 13
4: 141
Right 1142149994 16:88508510-88508532 GGGTTCCCCTGGTCTCTCCTGGG No data
1142149990_1142149993 -9 Left 1142149990 16:88508495-88508517 CCTTGGGCTCCACGTGGGTTCCC 0: 1
1: 0
2: 4
3: 13
4: 141
Right 1142149993 16:88508509-88508531 TGGGTTCCCCTGGTCTCTCCTGG 0: 1
1: 0
2: 1
3: 36
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142149990 Original CRISPR GGGAACCCACGTGGAGCCCA AGG (reversed) Intronic
910278319 1:85471321-85471343 GAGAACCAACGAGGAACCCAGGG - Intronic
913219019 1:116644582-116644604 TGGGACCCACTTGCAGCCCATGG - Intronic
914307941 1:146440076-146440098 GGGAACACAAGTGAAGCCAAGGG - Intergenic
914594168 1:149133057-149133079 GGGAACACAAGTGAAGCCAAGGG + Intergenic
914688445 1:150003630-150003652 AGGAACCCACGAGGAGCGTATGG - Intronic
918940718 1:190992996-190993018 GAGAACCCATGTGGAGGACACGG - Intergenic
919973987 1:202599122-202599144 GGGAACTCACCTAGAGACCATGG - Intronic
920155969 1:203951577-203951599 AGGAGCCCACATGGAGCTCAGGG + Intergenic
922717293 1:227884330-227884352 TGGATGCCACTTGGAGCCCACGG + Intergenic
1062845178 10:697809-697831 GAGAAACCACGTGCAGCCCTTGG - Intergenic
1066694311 10:38064352-38064374 GGGGACTCACCTGGGGCCCAGGG + Intronic
1066998208 10:42582824-42582846 GGGGACTCACCTGGGGCCCAGGG - Intronic
1068947475 10:62743982-62744004 AGGAAGCAACGTGGAGCACAAGG + Intergenic
1070159305 10:73856143-73856165 AGTAATGCACGTGGAGCCCATGG - Intronic
1070684882 10:78472919-78472941 GAGAGCCCATTTGGAGCCCAGGG - Intergenic
1070805056 10:79266070-79266092 GTGACCCCACTTGGAGGCCAGGG + Intronic
1071695096 10:87862563-87862585 GCGAACCGACCTGGAGCCCGAGG + Exonic
1072736719 10:97884129-97884151 GGGAACCCAGCTTCAGCCCATGG + Intronic
1074966732 10:118497358-118497380 TTGAACACACGTGCAGCCCAGGG - Intergenic
1075427322 10:122351992-122352014 GCGAACACACTTGGAGCTCACGG + Intergenic
1079106071 11:17573247-17573269 GGAAATCAACGGGGAGCCCATGG - Exonic
1083793339 11:65000023-65000045 GGGAGCCCACCAGGAACCCAGGG - Intergenic
1083842940 11:65315079-65315101 GGGAAGCCCCATGGAGCCCTAGG - Intronic
1084735021 11:71099221-71099243 GGGAACCCGGGTGGGGCCCAGGG + Intronic
1084752420 11:71213012-71213034 GGGACCCCAGGTGGAGGCAAAGG + Intronic
1085387932 11:76167806-76167828 GGGCTCCCACGGGGATCCCAGGG - Intergenic
1085694453 11:78692086-78692108 AGGCAGCCACTTGGAGCCCAGGG - Intronic
1085743961 11:79099185-79099207 GGGAATCCAGGTGGTGCCCAAGG - Intronic
1089474386 11:118746678-118746700 GGGAACATCAGTGGAGCCCAGGG - Intergenic
1089966992 11:122661525-122661547 TGGAACCCACCTGGAGCTGAAGG + Intronic
1091585271 12:1812284-1812306 TGGAACCCACCTGCAGCCCTGGG - Intronic
1100058944 12:90548645-90548667 GGGATGCCTCATGGAGCCCAAGG - Intergenic
1101400441 12:104382375-104382397 TGGAAGGGACGTGGAGCCCAGGG - Intergenic
1102038894 12:109788046-109788068 GGGGTCCCACGCTGAGCCCAGGG - Intronic
1102455035 12:113065797-113065819 GGGAGGCCACGGGGAGGCCAAGG + Intronic
1105475083 13:20721836-20721858 GGGGACGCAGGTGCAGCCCACGG - Exonic
1106885111 13:34176173-34176195 GGGAAGCCACTTGGGACCCAAGG + Intergenic
1108676047 13:52738986-52739008 GGGGACCCCCGTGTCGCCCATGG - Intronic
1113763711 13:112867736-112867758 CGGAACCCGCGTGCAGCCCCGGG + Intronic
1120914857 14:89701835-89701857 GGGAAGCCACGTGGTGGCCCGGG + Intergenic
1120998448 14:90434574-90434596 GGGAACTCATGGGGAGCCCGTGG + Intergenic
1122075562 14:99232582-99232604 GGGAATCCACGTGGGGGCCCTGG - Intronic
1124370787 15:29103689-29103711 GGGAGCCCAAGTGGAGTCCGAGG + Intronic
1124653355 15:31488540-31488562 GGGGAGCTAAGTGGAGCCCATGG - Intronic
1127265156 15:57355140-57355162 GGGAAACCAAGGGGAGCCCGGGG - Intergenic
1127412029 15:58718892-58718914 GGGAACCTAGGTAGAGTCCAGGG - Intronic
1131151177 15:90048362-90048384 GAGAACCCACGGGGTTCCCAGGG + Intronic
1131512548 15:93057188-93057210 GTGAAGCCACCTGGTGCCCATGG - Intronic
1132711225 16:1268882-1268904 GGGAGCCACAGTGGAGCCCAGGG + Intergenic
1132995053 16:2818401-2818423 GGGCACCCCCATGCAGCCCAAGG - Intronic
1133230106 16:4362362-4362384 GGGAATCTTGGTGGAGCCCAGGG + Intronic
1134329796 16:13240142-13240164 GGGAGGCCAGGCGGAGCCCAAGG - Exonic
1135065793 16:19308741-19308763 GGGAGCCCTCCTGGAGCCCTGGG + Intronic
1138426663 16:56938663-56938685 GGGAACCCAAGTACAGCTCAGGG - Intronic
1138657831 16:58501031-58501053 GGGACCCCAGGTGGAGCCCAGGG + Intronic
1139254130 16:65524858-65524880 AGAGACCTACGTGGAGCCCATGG - Intergenic
1139910552 16:70394959-70394981 GTGAGCCCCTGTGGAGCCCAAGG - Intronic
1141524552 16:84603443-84603465 GGGGACCCACTGAGAGCCCAGGG + Intronic
1141934813 16:87230220-87230242 GGCAACCCACATGAAGCACAGGG - Intronic
1142001887 16:87668925-87668947 TGGAGCCCACGTGGAGGCGAGGG - Intronic
1142149990 16:88508495-88508517 GGGAACCCACGTGGAGCCCAAGG - Intronic
1142304670 16:89278659-89278681 GGGAACCCACGCGGGTCCAAGGG + Intronic
1143270838 17:5673364-5673386 GGGTACCCAGGTGGGGGCCAGGG + Intergenic
1146411454 17:32589246-32589268 GGGAACCCACGGGGAGCAGCAGG - Intronic
1147985907 17:44307937-44307959 GGGAACCTCCGCAGAGCCCAAGG + Intergenic
1149772393 17:59331957-59331979 GGGACCCCACGCGGAACCGAGGG - Intronic
1151855280 17:76716812-76716834 GGGACCCCACGTGGAAGTCATGG + Intronic
1152230372 17:79111290-79111312 GGGACCCCACGTGGGCCGCAAGG - Intronic
1152307997 17:79532310-79532332 GGGACTCCATGTGGAGCCTAGGG + Intergenic
1155284293 18:24272142-24272164 CGGCACTCACGTAGAGCCCAAGG - Intronic
1161124050 19:2546137-2546159 GGGGACCCACGCAGAGCCCGGGG + Intronic
1161169017 19:2803884-2803906 GGGAGCTCACGGGGACCCCAGGG - Intronic
1161297173 19:3526019-3526041 GGGACCCCCCGGGAAGCCCAGGG + Intronic
1162327272 19:10006619-10006641 GGAAACCCACGTGGAGAGGAGGG + Intronic
1162725509 19:12687969-12687991 GGGAACCCTCGGGCAGCCCTAGG + Intergenic
1164051255 19:21587011-21587033 GAAAACCCAGGCGGAGCCCAGGG - Intergenic
1164989941 19:32675956-32675978 GGGAGCCACCGTGGAGGCCAGGG + Exonic
1165134619 19:33660006-33660028 AGGAAGCCTGGTGGAGCCCAGGG - Intronic
1165395361 19:35560809-35560831 GGGAACCCACCTGTGGCACAAGG + Exonic
1166137848 19:40788008-40788030 GGGAATCCACCTGCAGCCCCAGG + Intronic
1168186879 19:54705696-54705718 GGGAACCCATGGGGAGCCACAGG + Intergenic
928206620 2:29289221-29289243 GGGGTCCCACCTGGAGCCCATGG - Intronic
931257325 2:60584918-60584940 GGGAGCCCAAGGGGAGCCCAAGG - Intergenic
931257330 2:60584929-60584951 AGGAGCCCAAGGGGAGCCCAAGG - Intergenic
937266156 2:120615793-120615815 GGGAGCCCAGGGCGAGCCCAGGG + Intergenic
1172010779 20:31844629-31844651 GGGAAGCCACCTGCAACCCAGGG + Exonic
1172098873 20:32473945-32473967 GGGAGTCCACGTGGAGGCCGGGG + Intronic
1172808955 20:37633453-37633475 TGGAACCCTCTTGGAGACCAGGG - Intergenic
1173817685 20:46000294-46000316 GGGAAAACACGGGGAGCACATGG - Intergenic
1173889555 20:46495720-46495742 GGAAACACACGTGCATCCCATGG - Intergenic
1175072131 20:56343657-56343679 TGGAACCAACATGGAACCCAAGG - Intergenic
1175963559 20:62648871-62648893 TCGCACCCACGAGGAGCCCAGGG - Intronic
1176233250 20:64042478-64042500 GGGAACCCGCGTCCAGCCCCAGG - Intronic
1176389424 21:6156003-6156025 GGGGACCCACGTAGAGGGCAGGG - Intergenic
1179734045 21:43382235-43382257 GGGGACCCACGTAGAGGGCAGGG + Intergenic
1179798544 21:43799637-43799659 GGGAACCCACCTGGAGAACGGGG - Exonic
1180038319 21:45262445-45262467 GGGAGCCCAGGTGGACCCCAAGG - Intergenic
1180820310 22:18822638-18822660 TGGGACCCACTTGCAGCCCATGG - Intergenic
1180844618 22:18974345-18974367 GGGAACCCAGCTGGGCCCCAGGG - Intergenic
1181042530 22:20198986-20199008 GGGCAGCCGCCTGGAGCCCAGGG + Intergenic
1181206535 22:21257110-21257132 TGGGACCCACTTGCAGCCCATGG - Intergenic
1181773758 22:25145141-25145163 GGGAACCCACGCTGGGCCCCAGG - Intronic
1183795134 22:40111218-40111240 GCGAAACCACGTGGTGCTCAAGG + Intronic
1184743740 22:46444126-46444148 GGGAAGCTACGTGGAGGTCATGG - Intronic
1185136405 22:49075760-49075782 GGAAACACACTTGGAGCCCTGGG - Intergenic
1203220385 22_KI270731v1_random:38313-38335 TGGGACCCACTTGCAGCCCATGG + Intergenic
1203270440 22_KI270734v1_random:48513-48535 TGGGACCCACTTGCAGCCCATGG - Intergenic
954302072 3:49705406-49705428 AGGGACCCGCGGGGAGCCCATGG - Intronic
958025204 3:88041206-88041228 GGGAAGCCATTTGGAGCCCTTGG - Intergenic
961624776 3:128254382-128254404 TGGAACTCACGAGGAGCCCTGGG - Intronic
966772704 3:183518096-183518118 GGCAAACCAAGTAGAGCCCAGGG - Intronic
967926029 3:194648446-194648468 TGGTACCCACGTGCAGCACAGGG - Intronic
968006647 3:195247598-195247620 GGGGACACAGCTGGAGCCCAAGG + Intronic
968663626 4:1809323-1809345 GGGGACCCTGATGGAGCCCAAGG - Intergenic
968869308 4:3233470-3233492 GGGAACCCAGGTGGGTGCCATGG + Intronic
968905014 4:3446992-3447014 GGTTCCCCACATGGAGCCCAGGG + Intronic
969127527 4:4963666-4963688 AGTAGCCCACATGGAGCCCAGGG - Intergenic
969192952 4:5537194-5537216 GGGAACCCAGGCAGAGCCCAGGG + Intergenic
969212210 4:5696482-5696504 GGGGACCCACGCTGAGCCCAGGG + Intronic
970922588 4:21412319-21412341 GGGAATCCATGTGGAATCCATGG - Intronic
975495881 4:75035510-75035532 TTGACCCCACGTGGAGCTCATGG + Intronic
976825754 4:89258632-89258654 GGGAATCCAAGTGGAGTCAAAGG - Intronic
987106065 5:14640895-14640917 GGGAACCAACCTGGGGCCCAAGG - Intergenic
996706015 5:126499482-126499504 GGGAACCCAGGCAGAGCCCAGGG - Intergenic
997293969 5:132758420-132758442 GGCAACTCACGTGGTGCCCTAGG - Intronic
997518465 5:134506928-134506950 GGGAAGCCAAGTGGACTCCATGG + Intergenic
1000133724 5:158324214-158324236 TGGAAACAAAGTGGAGCCCATGG + Intergenic
1006257904 6:32845635-32845657 GGGAACCCACCAGCAGCTCATGG - Exonic
1006399463 6:33808216-33808238 AGGAACCCACCTGGAGAACAGGG - Intergenic
1007120642 6:39377829-39377851 GTGATGCCACGTGGAGCCCTGGG - Intronic
1014012519 6:116492766-116492788 GAAAACACACTTGGAGCCCAGGG + Intergenic
1016758529 6:147713351-147713373 GGCAAACCAAGTGGAACCCAGGG - Intronic
1016933835 6:149434384-149434406 GGGCACCTAGGTGGAGTCCATGG - Intergenic
1018749988 6:166795950-166795972 GGGGACCCACTTGGAACCCCAGG + Intronic
1019277205 7:182099-182121 GGGAACCCAGCTGGAGACCAGGG - Intergenic
1019654981 7:2187466-2187488 GAGACCCCACGTGGTGCCCCTGG - Intronic
1020471460 7:8540507-8540529 GAAAACCCAAGTGAAGCCCAGGG + Intronic
1029272601 7:99385879-99385901 GGACAGCCACATGGAGCCCATGG - Intronic
1029560521 7:101299978-101300000 AGGAGCCCACGTGGAGCCCACGG + Intergenic
1029561053 7:101303144-101303166 AGGAGCCCACGTGGAGCCCACGG + Intergenic
1029561871 7:101308443-101308465 GAGAAGCCACGGGGAGCCCGAGG + Intergenic
1029561934 7:101308674-101308696 TGGAGCCCACGTGGAGCCCACGG + Intergenic
1031254173 7:119427644-119427666 GGGGAGCCACCTGGAGCCAAGGG + Intergenic
1032054336 7:128672549-128672571 AGGTACCCTCGTGGAGCTCAGGG + Exonic
1032136437 7:129283221-129283243 AGGAACCCAAGTAGAGCCCAGGG - Intronic
1034671174 7:152859776-152859798 AGGAAGCCACTTGGAGCCCTGGG + Intergenic
1040886379 8:52267768-52267790 GGGAATCCACGGAGAGCCCATGG + Intronic
1042350284 8:67770122-67770144 GTGAACCCACTTGGAACCTATGG + Intergenic
1044151539 8:88782842-88782864 TGGAACTCAAGTGAAGCCCAGGG - Intergenic
1045262736 8:100590961-100590983 GGGAACCCAAACAGAGCCCAGGG + Intronic
1047220862 8:122917129-122917151 GTGACCCAACTTGGAGCCCAAGG - Intronic
1049178006 8:141206023-141206045 GGGAACACAGGTGGAGGCCCAGG - Intergenic
1049475145 8:142793842-142793864 GGGAACTCACCAGGACCCCAGGG + Intergenic
1049630457 8:143652051-143652073 AGGAAGCCACGTGGAGCACAGGG - Exonic
1049994038 9:1017822-1017844 GGGAACAGACGTGGATGCCAGGG - Intergenic
1051748337 9:20316805-20316827 GGCAACCCACGTCGAAACCATGG + Intergenic
1059789807 9:117628889-117628911 GGGAACACACTTAGATCCCAGGG - Intergenic
1062619714 9:137414821-137414843 TGCGACCTACGTGGAGCCCACGG - Intronic
1186622562 X:11256851-11256873 AGGAACCCAGGAGGAGCTCAGGG + Intronic