ID: 1142149994

View in Genome Browser
Species Human (GRCh38)
Location 16:88508510-88508532
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142149981_1142149994 30 Left 1142149981 16:88508457-88508479 CCGTGGCTGCAGAGCAGGCCACA 0: 1
1: 0
2: 2
3: 38
4: 361
Right 1142149994 16:88508510-88508532 GGGTTCCCCTGGTCTCTCCTGGG No data
1142149990_1142149994 -8 Left 1142149990 16:88508495-88508517 CCTTGGGCTCCACGTGGGTTCCC 0: 1
1: 0
2: 4
3: 13
4: 141
Right 1142149994 16:88508510-88508532 GGGTTCCCCTGGTCTCTCCTGGG No data
1142149983_1142149994 12 Left 1142149983 16:88508475-88508497 CCACAGAGTCCAACCACAGGCCT 0: 1
1: 0
2: 1
3: 19
4: 249
Right 1142149994 16:88508510-88508532 GGGTTCCCCTGGTCTCTCCTGGG No data
1142149987_1142149994 -1 Left 1142149987 16:88508488-88508510 CCACAGGCCTTGGGCTCCACGTG 0: 1
1: 0
2: 5
3: 16
4: 252
Right 1142149994 16:88508510-88508532 GGGTTCCCCTGGTCTCTCCTGGG No data
1142149986_1142149994 3 Left 1142149986 16:88508484-88508506 CCAACCACAGGCCTTGGGCTCCA No data
Right 1142149994 16:88508510-88508532 GGGTTCCCCTGGTCTCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type