ID: 1142150195

View in Genome Browser
Species Human (GRCh38)
Location 16:88509304-88509326
Sequence CCCCGCCCTGTGGCTCCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 227}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142150195_1142150205 11 Left 1142150195 16:88509304-88509326 CCTATGGGAGCCACAGGGCGGGG 0: 1
1: 0
2: 0
3: 19
4: 227
Right 1142150205 16:88509338-88509360 GATGGGGCCGATTAGATAAGTGG 0: 1
1: 0
2: 0
3: 2
4: 58
1142150195_1142150209 19 Left 1142150195 16:88509304-88509326 CCTATGGGAGCCACAGGGCGGGG 0: 1
1: 0
2: 0
3: 19
4: 227
Right 1142150209 16:88509346-88509368 CGATTAGATAAGTGGGTGCTGGG 0: 1
1: 0
2: 1
3: 1
4: 72
1142150195_1142150201 -7 Left 1142150195 16:88509304-88509326 CCTATGGGAGCCACAGGGCGGGG 0: 1
1: 0
2: 0
3: 19
4: 227
Right 1142150201 16:88509320-88509342 GGCGGGGCCGGGCGGAGCGATGG 0: 1
1: 1
2: 13
3: 141
4: 811
1142150195_1142150208 18 Left 1142150195 16:88509304-88509326 CCTATGGGAGCCACAGGGCGGGG 0: 1
1: 0
2: 0
3: 19
4: 227
Right 1142150208 16:88509345-88509367 CCGATTAGATAAGTGGGTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 41
1142150195_1142150203 -5 Left 1142150195 16:88509304-88509326 CCTATGGGAGCCACAGGGCGGGG 0: 1
1: 0
2: 0
3: 19
4: 227
Right 1142150203 16:88509322-88509344 CGGGGCCGGGCGGAGCGATGGGG 0: 1
1: 0
2: 1
3: 38
4: 468
1142150195_1142150206 12 Left 1142150195 16:88509304-88509326 CCTATGGGAGCCACAGGGCGGGG 0: 1
1: 0
2: 0
3: 19
4: 227
Right 1142150206 16:88509339-88509361 ATGGGGCCGATTAGATAAGTGGG 0: 1
1: 0
2: 0
3: 4
4: 27
1142150195_1142150202 -6 Left 1142150195 16:88509304-88509326 CCTATGGGAGCCACAGGGCGGGG 0: 1
1: 0
2: 0
3: 19
4: 227
Right 1142150202 16:88509321-88509343 GCGGGGCCGGGCGGAGCGATGGG 0: 1
1: 0
2: 2
3: 33
4: 301
1142150195_1142150210 20 Left 1142150195 16:88509304-88509326 CCTATGGGAGCCACAGGGCGGGG 0: 1
1: 0
2: 0
3: 19
4: 227
Right 1142150210 16:88509347-88509369 GATTAGATAAGTGGGTGCTGGGG 0: 1
1: 0
2: 0
3: 13
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142150195 Original CRISPR CCCCGCCCTGTGGCTCCCAT AGG (reversed) Intronic
900099170 1:953745-953767 CCCCTCCCTGTGTCTGTCATGGG - Intronic
900384096 1:2401434-2401456 CCCAGCCTTGTGGCTCCTTTTGG + Intronic
901702336 1:11052348-11052370 CCCCACCCTGAGGCTCCCCCGGG + Intergenic
902975439 1:20084909-20084931 CACCACCCTGTTACTCCCATGGG - Intronic
905550818 1:38837275-38837297 CTCCGGCCTTAGGCTCCCATTGG - Intergenic
905626888 1:39495252-39495274 CCCCGCCCTCTGGGTCCCACAGG - Intronic
905670046 1:39785517-39785539 CCCCGCCCCCTGGGTCCCACAGG + Intronic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
905873504 1:41418070-41418092 CCCCCTCCAGTGGCTCCCACTGG - Intergenic
907652854 1:56312236-56312258 CCCCTCGTTGGGGCTCCCATGGG - Intergenic
908478256 1:64510314-64510336 CCTTCCCCTGTAGCTCCCATTGG - Intronic
912383280 1:109259002-109259024 CGCGGCCCTGTGGCCCCCACGGG + Exonic
914678668 1:149923623-149923645 CCCCACCCTATGGCTACCAGCGG - Exonic
916713589 1:167432450-167432472 TCCCTCCTTCTGGCTCCCATGGG - Intronic
917141612 1:171841390-171841412 CCCCGCCCCGGGCTTCCCATCGG - Intergenic
917489259 1:175483731-175483753 CCCCACCATCTGGCTCCCTTGGG - Intronic
924479474 1:244414893-244414915 CCTAGCTCTGTGGCTCCCAATGG + Intronic
1063114484 10:3064224-3064246 CCCCTCCCAGTGGCTCCCCGTGG + Intergenic
1067057126 10:43058799-43058821 CCCAGCCCAGGGTCTCCCATAGG + Intergenic
1067297722 10:44984357-44984379 CCCCGCCCTGTGTGTGCTATGGG + Intronic
1069743904 10:70702815-70702837 TCCCTTCCTGTGGCTCCCAAGGG - Intronic
1069822844 10:71238200-71238222 CCCCTTCCTGTGGCTCCAAATGG - Intronic
1069882680 10:71603470-71603492 CCCCAGCCTGTGCCTCCCAGAGG - Intronic
1070627548 10:78061976-78061998 CCCCACTCTGTGGCTGCCGTGGG - Intergenic
1070848327 10:79541973-79541995 CCCAGCAGTGTGGCTCGCATGGG + Intergenic
1070925454 10:80218196-80218218 CCCAGCAGTGTGGCTCGCATGGG - Intergenic
1072954718 10:99878315-99878337 TCCCTCCCTCTGGCCCCCATGGG - Intronic
1073332405 10:102679042-102679064 CCGAGCCCTGTGGCTGCCCTGGG + Intronic
1076346950 10:129785696-129785718 CACCTCCCTGTGGCTCCGACGGG - Intergenic
1076411376 10:130253761-130253783 CTCAGCCCTGTGGCTCTCTTGGG - Intergenic
1076466904 10:130689229-130689251 ACCCTCCCTGTGGCTCACCTTGG + Intergenic
1076673763 10:132137176-132137198 CCCCGTCCTCTGGCTCCCAAGGG + Intronic
1077662503 11:4082430-4082452 CCTCTCCCTGTTCCTCCCATTGG + Intronic
1080281987 11:30567903-30567925 TCCCTCCCTGTGTCTCCCTTGGG + Intronic
1080285708 11:30608677-30608699 CTCCAGCCAGTGGCTCCCATTGG - Intergenic
1080683895 11:34499791-34499813 CCCAACCCTGTGACTTCCATTGG - Intronic
1083838919 11:65291810-65291832 CCCTGCCCTGTGGCACACACTGG - Intronic
1083936089 11:65870889-65870911 CCAAGGCCTGTGGCTCCCAGGGG + Intronic
1084248688 11:67878855-67878877 TCCAGTCATGTGGCTCCCATGGG - Intergenic
1085699363 11:78732483-78732505 GCACACCCTGTGGCTGCCATGGG - Exonic
1088805790 11:113350859-113350881 GCCCTCCCAGTGGCTCCGATGGG + Intronic
1090080576 11:123609651-123609673 CCCGGCCCTCGGGCTCCCATTGG + Intronic
1090830173 11:130415792-130415814 CCCCGCCCTCTTGCTCTCACAGG + Intronic
1096099559 12:48961425-48961447 TCCCTCCCTCTGGCTGCCATTGG + Intergenic
1096182898 12:49560194-49560216 CCCAGCCCTTGGGCTCCCGTTGG - Intronic
1096672200 12:53206703-53206725 CCCCTCCTTGTGACTCCCAGTGG - Intronic
1096876987 12:54637087-54637109 CTCCCACCTGTGTCTCCCATTGG - Intergenic
1099260991 12:80382536-80382558 CCCTGCCCAGTGCCTGCCATGGG + Intergenic
1101642977 12:106601778-106601800 CGCCGACCTGTGACTCCCAGTGG - Intronic
1103039823 12:117685720-117685742 CCCTGCCCTGTGGGTCACATGGG - Intronic
1103935571 12:124474804-124474826 CCCCGCCCTGTGCCATCCTTGGG + Intronic
1104931857 12:132343920-132343942 CCCCGCCCTGAGGACCCCAGAGG - Intergenic
1104978402 12:132562178-132562200 CCCAGAAGTGTGGCTCCCATGGG - Intronic
1113937572 13:114002455-114002477 CCCCGCCCTGCGCATCCCACTGG - Intronic
1115664503 14:35533574-35533596 CACCGCCCTGTGGCTGCTGTCGG - Intergenic
1118974648 14:70666213-70666235 CCCAGCCCTGTGGCTCCCTGTGG + Intronic
1119020214 14:71104649-71104671 CCCGGCGCTGTGGCTCACACTGG + Intronic
1121097804 14:91229868-91229890 CCACTCCCTGTGGCTTCCACTGG + Intergenic
1122856048 14:104560748-104560770 CCCAGCCTTGTGACTCCCCTTGG + Intronic
1122882326 14:104695664-104695686 CTCCTCCCTGTGGCTTCCACAGG + Intronic
1123047914 14:105527448-105527470 CCCCGCGCTCTGGGTCCCACCGG - Intronic
1123432583 15:20231338-20231360 CTCCGCCCTCTGCCTCCCCTAGG + Intergenic
1123579484 15:21703531-21703553 CCCCTCACTGTGTCTCCCACAGG - Intergenic
1123616111 15:22146042-22146064 CCCCTCACTGTGTCTCCCACAGG - Intergenic
1125529880 15:40406092-40406114 CCCCGCGCTGGCGCTCCCAACGG - Intronic
1129295599 15:74598436-74598458 CCCTGCCCCCTCGCTCCCATTGG - Intergenic
1129781647 15:78276359-78276381 CATCTCCCTCTGGCTCCCATGGG - Intronic
1129938055 15:79467001-79467023 CCCTGCCCTCAAGCTCCCATGGG - Intronic
1130086914 15:80785342-80785364 CCCCTCCCTGTGGCACTCCTGGG + Intronic
1130711374 15:86284978-86285000 CCCACCCCTGTGGCTTCCACAGG + Intronic
1130901786 15:88212788-88212810 TCCCACTCTGTGGCTGCCATTGG + Intronic
1131184013 15:90259985-90260007 CCAGGCCCTGTGGCTCTCGTGGG - Intronic
1202988354 15_KI270727v1_random:437776-437798 CCCCTCACTGTGTCTCCCACAGG - Intergenic
1132522146 16:396733-396755 TCCCGCCCTGGGGCTCACGTGGG + Intronic
1132660755 16:1060542-1060564 CCCCGCCCACTGGCTGCCAGTGG + Intergenic
1133452771 16:5917540-5917562 CCACCCACTGTGGCTCCCACAGG - Intergenic
1135509719 16:23071915-23071937 CCACTCCCTGTAGCTCCCTTTGG + Intronic
1136081383 16:27854482-27854504 CACCTCCCTGTGGCTCCCAGGGG - Intronic
1136228072 16:28872203-28872225 CACCGCCCTCTGGCTCCCCCTGG - Exonic
1137289489 16:47042167-47042189 CCCGGCCCTGTGGCCTCCACAGG + Intergenic
1137322169 16:47396285-47396307 TCCCTCCCTTTTGCTCCCATTGG - Intronic
1137574606 16:49590614-49590636 CCCAGCCCTGTGCTTCCCCTTGG + Intronic
1137913428 16:52402942-52402964 ACCCACCCTGAGGGTCCCATGGG - Intergenic
1139703779 16:68726302-68726324 CCCTGACCTGTGGCTGTCATGGG + Intergenic
1139848187 16:69935111-69935133 TCCCGCGCTGTGCCTCCCACGGG - Intronic
1140455814 16:75104991-75105013 CCCCGACCTCTGGCTCCGAGCGG + Intronic
1140743576 16:77962386-77962408 CCCCTACCTATGGCTCCCTTTGG - Intronic
1141981441 16:87552689-87552711 ACCCGCCCTTTGGTTTCCATTGG + Intergenic
1142150195 16:88509304-88509326 CCCCGCCCTGTGGCTCCCATAGG - Intronic
1142217335 16:88836159-88836181 CCTCGCCCTGTGGGACGCATGGG - Intronic
1142471850 17:169067-169089 CCCCGCCCTGGGCCTCTCAGAGG + Intronic
1142771832 17:2103710-2103732 CAACACCCTGTAGCTCCCATTGG + Intronic
1143058730 17:4182213-4182235 CCCCCCGCTGTGGCTTGCATTGG - Exonic
1144729167 17:17516873-17516895 CCCCGCCCAGTGGCTACCCCAGG + Intronic
1144788676 17:17845659-17845681 CCCAGCCCTTTGGCTGCCTTTGG - Intronic
1145062792 17:19743304-19743326 CCACGCCCAGTGGCTCCGAGTGG + Exonic
1145063847 17:19748798-19748820 CCCCAGCCTGTGGCTCCCCAGGG - Intronic
1145067539 17:19772061-19772083 CCCAGCCCTGTGGAGCCCCTGGG - Intronic
1145760467 17:27422672-27422694 TGGCACCCTGTGGCTCCCATAGG - Intergenic
1146380499 17:32323817-32323839 CCCCACCCTGTGGCCCCGCTTGG - Exonic
1147791812 17:43018466-43018488 CCTTGGCCTGTGGCTCCCAGAGG - Intronic
1148136634 17:45296769-45296791 GCCCACCCTGTTCCTCCCATAGG + Intronic
1148486032 17:47991526-47991548 CCCTGCCCTTTGGCTCACAAAGG + Intergenic
1148863447 17:50616503-50616525 CCCCACCCTGTGGCTGACGTAGG + Intronic
1149194489 17:54102886-54102908 CCCAGCCATGGGGCTCCCTTGGG - Intergenic
1151457910 17:74237523-74237545 CCCCTCCCTCTGCCTCCCACCGG - Intronic
1154028002 18:10725608-10725630 CTCCGCCCTCTGGCTCACAGAGG + Intronic
1156034695 18:32753424-32753446 CCCGCCCCTGTGGCTCACATGGG + Intronic
1157482349 18:48063426-48063448 CTCTGCCCTGGGGCTCCCAGAGG + Intronic
1160502734 18:79410434-79410456 CCCCGCCCTGCCGCTCCCCACGG + Exonic
1161076234 19:2287121-2287143 CTGCCCCCTGTTGCTCCCATGGG + Intronic
1161088346 19:2345231-2345253 CTCCGCCCTGTGCCTCCCCCAGG + Exonic
1161301715 19:3545933-3545955 CCCCTGCCTATGACTCCCATTGG + Intronic
1161397630 19:4052800-4052822 CCAAGTCCTGTGGCTCCCAGGGG + Intronic
1161767717 19:6216374-6216396 CTCCGCCCCCTGGCTCCCACCGG + Intronic
1162312850 19:9917457-9917479 CTCCCTCCAGTGGCTCCCATTGG - Intronic
1162407825 19:10486273-10486295 CCTCCCCCTGAGGCCCCCATTGG + Exonic
1162413297 19:10518936-10518958 TCCCACCCTGCGGGTCCCATTGG - Intergenic
1162597353 19:11639704-11639726 CCCCGCCCAGCGGCTCTGATTGG - Intergenic
1162746182 19:12800064-12800086 CCCAGCCCTGTGGCTAGCAGCGG - Intronic
1164213025 19:23116944-23116966 CCCCGCCCAGTGTCCCCGATTGG - Intronic
1164753598 19:30673493-30673515 TCCCGCCCTGTGCCTGCCACGGG + Intronic
1165958691 19:39517381-39517403 CCCGTCCTTGTGGCTCCCATGGG + Intronic
1166046412 19:40233304-40233326 CCCAGCCCTGCAGCTCCCAAGGG + Exonic
1167464271 19:49642041-49642063 CCCCGCCCCATGTGTCCCATTGG + Intergenic
1168018732 19:53594058-53594080 ACCCACCTTGTGGCTCCCAAAGG + Intergenic
1168163941 19:54533764-54533786 CCGAGCCCTGTGGTTCCCCTAGG + Exonic
926350440 2:11989335-11989357 CCCCGCCGTGTGGTTCCTGTTGG + Intergenic
927065108 2:19463238-19463260 CCCCTTACTGTGCCTCCCATTGG + Intergenic
928518174 2:32063563-32063585 CGCCGCCTGGTGGCTCCCAGCGG - Intergenic
931225381 2:60324815-60324837 CCCCACCCTGTGCCTTCCTTAGG + Intergenic
931464484 2:62474650-62474672 CCCTGGGCTGTGTCTCCCATGGG - Intergenic
932121223 2:69102472-69102494 CCCTCCCCTGTGGCTCCCTCCGG + Intronic
932503319 2:72204301-72204323 CCCCGCCCTCTGGCTCCTTGAGG + Intronic
935444558 2:103142175-103142197 CCCAGCCCTCTGGCTGCCTTTGG + Intergenic
937295091 2:120805260-120805282 CCCCTGCCTGTCGCTCCCCTTGG + Intronic
937360195 2:121224287-121224309 CCCAGCCCTGTGGATCCCCGTGG - Exonic
938094325 2:128451716-128451738 CCCCGCCCTTTGGCTGTCCTGGG + Intergenic
938263726 2:129912014-129912036 CCCCTGCCTGTGCCTCCCACCGG + Intergenic
944413899 2:199464818-199464840 CCCTGCCCAGTGGCTCACCTCGG + Intronic
945881395 2:215328456-215328478 CTCCGCCCTGTGCCTCCAAGTGG + Intronic
948179486 2:235968452-235968474 CCCAGCCCTGTGTCTGCCATTGG - Exonic
1171134752 20:22686273-22686295 CTCCGGCCAGTGCCTCCCATTGG - Intergenic
1173227240 20:41169057-41169079 CAGCACCCTGTGGCTCCCACAGG + Exonic
1174092273 20:48058889-48058911 ACTCTCCCTGGGGCTCCCATGGG + Intergenic
1175737073 20:61394571-61394593 CCCCGCCCTGGTGCTCTCTTCGG - Intronic
1176085371 20:63293392-63293414 CCCGGTCCTGTGGCTCACAGGGG - Intronic
1179176091 21:39009336-39009358 CCCCGTTCTGTGGCTCCCCCAGG - Intergenic
1179303716 21:40135968-40135990 CCCAGGCCTTTGGCTCCCACTGG - Intronic
1179723022 21:43325963-43325985 CCCCACCCTGAGGCTTCCAGTGG - Intergenic
1179839105 21:44058776-44058798 CCCCTCACTGTGGCTCCCTCTGG - Intronic
1180144289 21:45910690-45910712 CCCGGCCCTGTGCCTTCCCTCGG - Intronic
1180253371 21:46605170-46605192 CCCCCGCCTTCGGCTCCCATTGG - Exonic
1181062000 22:20286071-20286093 CCTCGGCCAGTGGCTCCCAGGGG + Intergenic
1181100578 22:20536276-20536298 GCCTGGCCTGTGGCTCCCAGGGG - Intronic
1181467411 22:23117630-23117652 CCTTGCCCTGTGGCTACCACTGG - Intronic
1181783549 22:25209481-25209503 CCCCTTCCTGAGGCCCCCATAGG - Intergenic
1182420245 22:30245424-30245446 CCATGCCCCGTGGCCCCCATGGG - Intronic
1184354409 22:43969408-43969430 CCACGCCCTGTGTCTCCCTCTGG - Intronic
1184667144 22:45995104-45995126 TCCTGCCCTGTGTCTCCCACGGG - Intergenic
1185212144 22:49576329-49576351 CTCCCCCCTGGGGCTCCCACAGG - Intronic
1185247062 22:49778588-49778610 CCCCCCGTTGTGACTCCCATGGG - Intronic
1185414894 22:50704582-50704604 CCCTGCGCTGTGGCTCCCCGTGG + Intergenic
949942395 3:9165020-9165042 ACCTGCCCTGTGGTTCCCCTTGG + Intronic
950670822 3:14524379-14524401 CCCCGCCCGGTGGGTGCCCTTGG - Exonic
954423687 3:50432230-50432252 CCCAGCCCTGTGATTCCCAAGGG + Intronic
954455046 3:50593179-50593201 GCCAGGCCTGAGGCTCCCATCGG - Intergenic
954542510 3:51403442-51403464 ACCCGCCATGTGGCCCCCATGGG - Intronic
957216719 3:77329657-77329679 TCCTGCCCTGTGCCTCACATTGG + Intronic
961458263 3:127034776-127034798 CCTGGCCCAGTGGCTCCCAGAGG - Exonic
962198938 3:133385569-133385591 CCCCTCCCACTGGCACCCATGGG + Intronic
962910888 3:139848537-139848559 CCCCACCCTGTGGCAGCCACAGG - Intergenic
963025023 3:140911023-140911045 CCCGACCCTGTGACTCCCAAAGG + Intergenic
965758921 3:172054206-172054228 CCCATCCCTGTGGCTGCCTTGGG - Intronic
965788697 3:172364327-172364349 CCCAGACCTGTGGCTTCCATTGG + Intronic
966911209 3:184561498-184561520 CCCCGCCTCCTGGCGCCCATTGG - Intronic
967359029 3:188609299-188609321 CCCATCCCTGTGGCTCCAATCGG + Exonic
967490375 3:190083810-190083832 CCCTCCCTGGTGGCTCCCATGGG + Intronic
967833710 3:193943399-193943421 CCCAGCCCTGTGGCTTTGATGGG + Intergenic
968915043 4:3493644-3493666 GCGCGCCCTGTGGCTGCCACCGG + Exonic
968949847 4:3684777-3684799 CTCCTGCCTGTGGCTCCCAATGG + Intergenic
969343835 4:6558948-6558970 CCCAGCCCTGCGGCTCTGATGGG + Intronic
975371959 4:73599489-73599511 CTCCTCCCTGTGTCTCCCACTGG + Intronic
975977444 4:80115560-80115582 CTCCCCCCTGTGGCTCCATTAGG - Intronic
978918071 4:114149152-114149174 CCACCCCCTGTTGCTCCCAGGGG - Intergenic
980937798 4:139242672-139242694 CCCTGCCCTGTGGCCCCCGGGGG - Intergenic
984338527 4:178423534-178423556 CACAGCCCTGTGGCTCCAGTTGG + Intergenic
984947843 4:184983673-184983695 CCCAGAGCTGTGGCTCCCATGGG + Intergenic
985563092 5:601835-601857 CCCCTCACTGGGGCTCCCAGGGG - Intergenic
988510919 5:31864079-31864101 CCCCTGCCAGTGCCTCCCATTGG - Intronic
988517458 5:31917159-31917181 CCCAATCCTGTGGCTCCCAAGGG - Intronic
997734148 5:136201089-136201111 CCCAGCCCTTCAGCTCCCATTGG - Intergenic
998326835 5:141288421-141288443 CCTCTCCCTGTGCCTCCCAGGGG - Intergenic
999379210 5:151108619-151108641 CCCCACCCAGTGCCTCCCACAGG + Intronic
1001672401 5:173484875-173484897 GACCGACCTGTGGCTCCCTTTGG - Intergenic
1002137446 5:177116713-177116735 TCCCGCCCTATTGCTTCCATGGG - Intergenic
1002563818 5:180099269-180099291 CCCTGCCCTGTGGAGCCCCTGGG + Intergenic
1002600894 5:180353418-180353440 CCCCGCCCGCCTGCTCCCATTGG + Intergenic
1003389709 6:5703185-5703207 CCCATCCCTGTGGCTACCAGAGG - Intronic
1005317223 6:24614913-24614935 CCCTGCCCTGTGGCTTACAATGG - Intronic
1005419870 6:25637991-25638013 CCCCTCCATGTGGCTCACCTGGG - Intergenic
1006808743 6:36806278-36806300 CCTCACCCTGTGGCTTCCAGTGG + Intronic
1007451085 6:41940895-41940917 CCCAGCTCTCTGGCTACCATGGG - Intronic
1007740161 6:44005059-44005081 CCCCACCCTCTGGCTCCCCATGG + Exonic
1012927039 6:105278228-105278250 CCCCGCCCCGTGGCCCGCCTTGG + Exonic
1013306356 6:108850341-108850363 CCTTGCCCTCTGGCTCCCCTAGG + Intronic
1016916797 6:149251380-149251402 ACCCGGCCTGTGACTCCCACTGG + Intronic
1019527614 7:1487720-1487742 CCCCGCCCTGCGCCTGCCGTCGG - Intronic
1020282315 7:6655880-6655902 GCCCGCCCAGTGGCTTCCATGGG - Exonic
1022496481 7:30856097-30856119 CCCCCACCTCTGCCTCCCATTGG + Intronic
1023829104 7:44028919-44028941 CACAGCCCTGTGGCACCCAAGGG + Intergenic
1023882637 7:44329219-44329241 CCCTGCCCTTTGGCTCTCAAGGG - Intronic
1024234881 7:47390516-47390538 CCACGCTTTGGGGCTCCCATGGG - Intronic
1026764947 7:73154693-73154715 ACCCGCCCCGTGCCTCCCCTCGG + Intergenic
1027041419 7:74964463-74964485 ACCCGCCCCGTGCCTCCCCTCGG + Intergenic
1027082221 7:75237913-75237935 ACCCGCCCCGTGCCTCCCCTCGG - Intergenic
1027593323 7:80141194-80141216 GTCCGCCCTCTGGCTCCCAAAGG + Intronic
1029390784 7:100272416-100272438 ACCCGCCCCGTGCCTCCCCTCGG - Intergenic
1029424988 7:100489409-100489431 CCCAGCCTTGAGGCTCTCATAGG - Exonic
1029739405 7:102483176-102483198 CACAGCCCTGTGGCACCCAAGGG + Exonic
1029757406 7:102582355-102582377 CACAGCCCTGTGGCACCCAAGGG + Exonic
1029775346 7:102681416-102681438 CACAGCCCTGTGGCACCCAAGGG + Intergenic
1030065575 7:105656392-105656414 CCCTGACCTCTGGCTCCCACAGG + Intronic
1032516086 7:132507431-132507453 CCCCAGCCTGTAGCCCCCATGGG - Intronic
1033684238 7:143624034-143624056 CCCTGTCCTGGGGCTCCCGTGGG + Intronic
1033687415 7:143703253-143703275 CCCTGTCCTGGGGCTCCCGTGGG + Exonic
1033700373 7:143833589-143833611 CCCTGTCCTGGGGCTCCCGTGGG - Intergenic
1035484720 7:159213740-159213762 GCCCACCCTGTGGCTCTCTTTGG - Intergenic
1036105544 8:5834140-5834162 CCTCCCACTGTGGCACCCATAGG - Intergenic
1036743808 8:11390028-11390050 GCCCGCCCTGTGTCTCCGAGAGG - Intergenic
1040550229 8:48431856-48431878 CCTCGCCCAGTGGCACCCATGGG - Intergenic
1048496040 8:134936975-134936997 CTCCTCCCTCTGACTCCCATTGG - Intergenic
1051511956 9:17888166-17888188 CCTTGCCATGTGGCTCCCATGGG - Intergenic
1051779046 9:20668995-20669017 CCTTGCCCTGTGACTTCCATAGG + Intronic
1053174406 9:35911774-35911796 CCTTGCCATGTGGCTGCCATGGG + Intergenic
1054949725 9:70836336-70836358 CCTCACACTGTGGCTCCCTTTGG + Intronic
1060016909 9:120094664-120094686 CCCCGCCCTGTGTGTCCCCTGGG - Intergenic
1060050786 9:120376731-120376753 CCCAGCCCTGGGCCTACCATAGG + Intergenic
1060401656 9:123353218-123353240 CTCCGGCCTGTGCCTCCCACTGG + Intergenic
1060984724 9:127813476-127813498 ACCCACCCTGTGGCTCACAGTGG + Exonic
1061806817 9:133141444-133141466 CCCTGCCCTTGGGCTCCCATAGG - Intronic
1062381342 9:136288313-136288335 CCCCTCCCTCTGGCTCCTTTTGG - Intronic
1189376102 X:40467295-40467317 CCCCACCCTTTGGCTCCCGTTGG - Intergenic
1194014775 X:88605527-88605549 CCCCACCCTGTTACTCCCAGGGG + Intergenic
1195971236 X:110475921-110475943 CCCGGTGCTGTGGCTCACATCGG + Intergenic
1196804741 X:119574395-119574417 CCCCGCCCCGGGCCTCCCGTGGG + Intergenic
1197891682 X:131275711-131275733 CCCAGTTCTGTGGTTCCCATGGG - Exonic