ID: 1142150751

View in Genome Browser
Species Human (GRCh38)
Location 16:88511568-88511590
Sequence CCTTGAGCCAAGTCCTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 138}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142150744_1142150751 15 Left 1142150744 16:88511530-88511552 CCTCACCCTCACTCACGGACACT 0: 1
1: 0
2: 5
3: 36
4: 331
Right 1142150751 16:88511568-88511590 CCTTGAGCCAAGTCCTCAGGAGG 0: 1
1: 0
2: 0
3: 17
4: 138
1142150746_1142150751 9 Left 1142150746 16:88511536-88511558 CCTCACTCACGGACACTTCCATC 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1142150751 16:88511568-88511590 CCTTGAGCCAAGTCCTCAGGAGG 0: 1
1: 0
2: 0
3: 17
4: 138
1142150742_1142150751 17 Left 1142150742 16:88511528-88511550 CCCCTCACCCTCACTCACGGACA No data
Right 1142150751 16:88511568-88511590 CCTTGAGCCAAGTCCTCAGGAGG 0: 1
1: 0
2: 0
3: 17
4: 138
1142150739_1142150751 30 Left 1142150739 16:88511515-88511537 CCTAGGCTCCAGGCCCCTCACCC No data
Right 1142150751 16:88511568-88511590 CCTTGAGCCAAGTCCTCAGGAGG 0: 1
1: 0
2: 0
3: 17
4: 138
1142150740_1142150751 22 Left 1142150740 16:88511523-88511545 CCAGGCCCCTCACCCTCACTCAC 0: 1
1: 0
2: 3
3: 108
4: 965
Right 1142150751 16:88511568-88511590 CCTTGAGCCAAGTCCTCAGGAGG 0: 1
1: 0
2: 0
3: 17
4: 138
1142150747_1142150751 -9 Left 1142150747 16:88511554-88511576 CCATCCATTCTCAGCCTTGAGCC 0: 1
1: 0
2: 4
3: 19
4: 265
Right 1142150751 16:88511568-88511590 CCTTGAGCCAAGTCCTCAGGAGG 0: 1
1: 0
2: 0
3: 17
4: 138
1142150743_1142150751 16 Left 1142150743 16:88511529-88511551 CCCTCACCCTCACTCACGGACAC 0: 1
1: 0
2: 1
3: 34
4: 367
Right 1142150751 16:88511568-88511590 CCTTGAGCCAAGTCCTCAGGAGG 0: 1
1: 0
2: 0
3: 17
4: 138
1142150745_1142150751 10 Left 1142150745 16:88511535-88511557 CCCTCACTCACGGACACTTCCAT 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1142150751 16:88511568-88511590 CCTTGAGCCAAGTCCTCAGGAGG 0: 1
1: 0
2: 0
3: 17
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142150751 Original CRISPR CCTTGAGCCAAGTCCTCAGG AGG Intronic
900376986 1:2359378-2359400 CCTTGGGCACAGTCCTCTGGGGG - Intronic
900647607 1:3716018-3716040 CCTTGAGCCATGTCCTAAACAGG - Intronic
901002510 1:6155595-6155617 CCTTCAGCCAGTTCCTCAGGTGG - Exonic
901010595 1:6199527-6199549 CCTGGAGCCGAGGCCTCACGCGG + Intronic
902411219 1:16212570-16212592 GTTGCAGCCAAGTCCTCAGGGGG + Exonic
902894512 1:19469689-19469711 CCTTGAGATAAGTCCCCAGGAGG - Intronic
904264965 1:29312923-29312945 CCTTGACCCAGGTGCTGAGGAGG + Intronic
906202192 1:43967395-43967417 CCTTGATCCACATGCTCAGGAGG - Exonic
911366561 1:96945951-96945973 TCTTCAGTCACGTCCTCAGGCGG + Intergenic
917957215 1:180111848-180111870 CTTTGAGCCCAGTCTTCAGTAGG - Exonic
919975060 1:202605010-202605032 CCTTGTGCCAAGTCTTGAGAGGG + Intronic
920262524 1:204698926-204698948 CCATGGGCCAATTCTTCAGGAGG + Intergenic
920374348 1:205499364-205499386 CCTGGAGACAAGTGCTCTGGAGG - Intergenic
922603129 1:226871742-226871764 CCTTCAGCCAAGACCTTTGGCGG + Intronic
924242324 1:242053266-242053288 ACTTGAGACAATACCTCAGGTGG - Intergenic
1075673779 10:124281921-124281943 CCGTAAGCCGAGTCCTCTGGAGG - Intergenic
1076022397 10:127084859-127084881 CCATCACCCAAGTCTTCAGGAGG - Intronic
1076120715 10:127934843-127934865 CCGTGAGCCACGGCCTCAGGAGG + Intronic
1076236061 10:128864597-128864619 GATTGAGCCTGGTCCTCAGGAGG + Intergenic
1078141608 11:8697274-8697296 GCTTGAGGCAAGGCCTCAGAAGG + Intronic
1078355308 11:10628156-10628178 CCGTGTGCCAGGTTCTCAGGTGG + Intronic
1078376111 11:10794643-10794665 ATTTGAGCCAAGACCTGAGGAGG + Intergenic
1079540586 11:21568832-21568854 GCCTCAGGCAAGTCCTCAGGAGG - Intronic
1083731147 11:64653402-64653424 CCTTTACCCAAGTCAGCAGGAGG - Intronic
1083792638 11:64995799-64995821 CCTTGGGCCATGTCCACAGCGGG + Intronic
1085053170 11:73390109-73390131 CCTGGAGCCAAGTCTGCAGGTGG - Intronic
1089443944 11:118536722-118536744 ACTTTAGCCCAGTCCTGAGGTGG - Intronic
1089601296 11:119616921-119616943 CCGTGAGCCATGGTCTCAGGAGG - Intergenic
1089738379 11:120564865-120564887 CCTTGTGCGAAGTCCTGAGCCGG - Intronic
1092052996 12:5486189-5486211 TCTGCAGCCAAGTCCTCTGGGGG + Intronic
1094814649 12:34171046-34171068 ACTTGAGACAACACCTCAGGTGG + Intergenic
1099286962 12:80725057-80725079 CTTTTACCCAAGTCCTCAGTAGG - Intergenic
1101822717 12:108196161-108196183 CCTGGAGCCGAGCCCTCAAGGGG + Exonic
1102026239 12:109715500-109715522 CCTTGACCCAAGGCCGGAGGGGG + Intronic
1102477294 12:113196815-113196837 CCTGGAGGGAAGTGCTCAGGGGG - Intronic
1103399066 12:120630284-120630306 CCATCTGCCAATTCCTCAGGAGG - Intergenic
1114688551 14:24558554-24558576 CCATGAGCCAAGAACGCAGGGGG + Intergenic
1119180118 14:72599933-72599955 CCTGGCCCCAAGGCCTCAGGGGG + Intergenic
1121494104 14:94380141-94380163 CCTGGAGCAGAGACCTCAGGAGG + Intronic
1126333079 15:47555114-47555136 ACTTGAGCCACTTCCCCAGGAGG + Intronic
1128135073 15:65256877-65256899 CCTAGAACCAATTCCTCTGGGGG + Intronic
1128536909 15:68498479-68498501 CCTTGGGCAAAATCCTAAGGTGG + Intergenic
1129611872 15:77066925-77066947 CCTTCTGCAAAGTCCTGAGGTGG + Intronic
1130995933 15:88904199-88904221 CCTAGAGCCAAGCACCCAGGAGG + Intronic
1132995057 16:2818421-2818443 CATTGAGCCAAGGCCTCCAGGGG - Intronic
1133279158 16:4655414-4655436 CCTTGTGCCAGGTCCTGAGAGGG - Intronic
1137652415 16:50131873-50131895 CCTTCAGCAAACACCTCAGGTGG + Intergenic
1139494400 16:67305859-67305881 CATTGAGACTAGTCCTCTGGTGG + Intronic
1139803383 16:69542916-69542938 CCTTAGTCCCAGTCCTCAGGAGG - Intergenic
1142150751 16:88511568-88511590 CCTTGAGCCAAGTCCTCAGGAGG + Intronic
1144171553 17:12664228-12664250 CCATGAGCCAAGTACTCGGGCGG + Intergenic
1146039620 17:29438597-29438619 CCTTGGGCCCAGAGCTCAGGAGG + Intronic
1146652222 17:34613846-34613868 CCTGGAGCCTGATCCTCAGGAGG + Intronic
1147964156 17:44184756-44184778 CCATGAGCCAGCTACTCAGGAGG - Intergenic
1156456024 18:37294756-37294778 AATTGAGCCATGGCCTCAGGTGG - Intronic
1157108497 18:44797662-44797684 CCTTGAACCCAGTACTCTGGGGG + Intronic
1157485667 18:48085117-48085139 CCTTGAGCCTGGTCCTCTGCTGG + Intronic
1160551479 18:79696375-79696397 CCTTGAGCCAAGTCCTAACTGGG + Intronic
1165211013 19:34235820-34235842 CCATGCTCCAAGTCCTCAAGAGG - Intergenic
1165394571 19:35557447-35557469 CCTTGACCCCAGTCCTCACCTGG - Intronic
1166117842 19:40666903-40666925 CCTTGGGCCAAGGTCTCATGGGG - Exonic
1166279916 19:41785152-41785174 CCTTGAGCCAAGACCAAAGAAGG + Intergenic
1168031180 19:53681182-53681204 CCTGTAGACAAGTACTCAGGAGG - Intergenic
926809679 2:16745359-16745381 CCTGGAGGCAGGTCCTCTGGAGG - Intergenic
926914145 2:17877554-17877576 CCTTGAGCCAAGCGCTGGGGAGG - Intergenic
927043290 2:19251619-19251641 CCTTGAACCCAGTCTTCTGGTGG - Intergenic
927062847 2:19440671-19440693 CCTTGAGCCCAGACTTCAGTGGG + Intergenic
927250810 2:20993484-20993506 CCCTGAGCCAAGTCCTACTGAGG - Intergenic
932788623 2:74632390-74632412 CCTTGGGCCAAGTCCTCCTCAGG + Intronic
935786283 2:106551772-106551794 CCTGGAGCCCAGTCCTTAAGAGG + Intergenic
935945975 2:108287064-108287086 CCTTGAGCCAGGCATTCAGGAGG + Intergenic
939789253 2:146550852-146550874 CCTGTAGACAAGTCCTCAGCAGG + Intergenic
940286459 2:152037823-152037845 CCGTGAGCCAAGACCTCAGCAGG + Intronic
941686505 2:168454108-168454130 GCTTGAGCCAAGACTACAGGAGG + Intergenic
943761547 2:191614924-191614946 CATTGAGCCAAGCCCTGATGAGG - Intergenic
947457298 2:230266612-230266634 CCTTCAGCCAAGACTTCAGCTGG - Intronic
947591960 2:231390954-231390976 CCTTGAGCCAGGGCCAGAGGAGG - Intergenic
948461997 2:238134291-238134313 CCTTGATCCAGCTCCTCAGCTGG - Intergenic
948467593 2:238159666-238159688 CTTTGAGTCAAGTGATCAGGTGG + Intronic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1171059827 20:21945470-21945492 CCTTCAGCCAAGTCCAACGGGGG - Intergenic
1171133119 20:22673633-22673655 AATTGAGCCAAGCCTTCAGGGGG + Intergenic
1171149720 20:22816636-22816658 ACTTGAGCCAAGTACTAATGAGG - Intergenic
1171293470 20:23995769-23995791 CTTTGAGCCAGGTGGTCAGGAGG + Intergenic
1175479637 20:59301914-59301936 TCTTGGGCCAGGCCCTCAGGGGG - Intronic
1175696737 20:61108382-61108404 CCTGGAGCCTCGGCCTCAGGGGG - Intergenic
1175804477 20:61819970-61819992 CCTTGAGCCAAGCCCAGGGGTGG + Intronic
1179265503 21:39799021-39799043 ACTTAGGCCAGGTCCTCAGGGGG + Intronic
1180824526 22:18853485-18853507 CTTTGAGCCAGGTGGTCAGGAGG + Intronic
1180869712 22:19139195-19139217 CCTTCAGCCAAGCCCTGAGCAGG - Exonic
1181210987 22:21289430-21289452 CTTTGAGCCAGGTGGTCAGGAGG + Intergenic
1181398513 22:22637458-22637480 CTTTGAGCCAGGTGGTCAGGAGG - Intergenic
1181501250 22:23316816-23316838 CTTTGAGCCAGGTGGTCAGGAGG - Exonic
1181650902 22:24258602-24258624 CTTTGAGCCAGGTGGTCAGGAGG + Intergenic
1181706479 22:24652137-24652159 CTTTGAGCCAGGTGGTCAGGAGG - Intergenic
1181983041 22:26779819-26779841 TCTTGAGCCTAGGTCTCAGGAGG + Intergenic
1182929010 22:34155242-34155264 CCTTGATCCAAGTTCTTGGGTGG - Intergenic
1183079397 22:35446936-35446958 GCATGAGCCAAGCCCTCCGGGGG + Intergenic
1183992479 22:41607133-41607155 TATTGAGCCAAGTCTTCAGGTGG + Intronic
1184765247 22:46568965-46568987 CCTTGAGCAAAGACTTGAGGAGG + Intergenic
1185046233 22:48529966-48529988 CCATGAGCTTAGTCCTCAGGGGG - Intronic
1203215959 22_KI270731v1_random:6000-6022 CTTTGAGCCAGGTGGTCAGGAGG - Intergenic
1203274664 22_KI270734v1_random:79390-79412 CTTTGAGCCAGGTGGTCAGGAGG + Intergenic
950191162 3:10977156-10977178 CCTTGAGCCCAGGCATCAGCAGG - Intergenic
955229181 3:57084007-57084029 ACTTGAGCCCTGTCCTGAGGTGG + Intergenic
966928227 3:184659313-184659335 CATTGAGCCCAGTCCCCAGTCGG + Intronic
966931242 3:184677185-184677207 CTTTGAACCAAGTCTTCAGGCGG + Intronic
967437006 3:189458808-189458830 GCTTGTGCCAAGTGCTCTGGGGG - Intergenic
970167562 4:13255745-13255767 CATTTAGCCATGTCCTCACGTGG + Intergenic
976158571 4:82173969-82173991 CCTTGAACAAAGTCCAAAGGTGG - Intergenic
977303374 4:95294283-95294305 ACTTGATCCAAATCCACAGGTGG + Intronic
982000365 4:151015992-151016014 GCTTCTGCCAAGTCCTGAGGCGG + Intergenic
984813538 4:183817479-183817501 ACTTAAGAAAAGTCCTCAGGTGG + Intergenic
985074504 4:186200170-186200192 CCTAGAGCCCAGGCCTCAGTAGG - Intronic
985144956 4:186886857-186886879 CCTGTAGTCCAGTCCTCAGGAGG + Intergenic
985441986 4:189988628-189988650 ACTTGAGACAATACCTCAGGTGG + Intergenic
985544507 5:502399-502421 CTTTGAGCAAAGCCCTGAGGTGG - Intronic
999198873 5:149802118-149802140 CCTTGGGCCAAGTCCTGAGAAGG - Intronic
1002784443 6:391403-391425 CTTTGCGCCAGGACCTCAGGAGG - Intergenic
1003520014 6:6850470-6850492 CCGTGAGTCCAGACCTCAGGAGG + Intergenic
1005135192 6:22560333-22560355 CCTTGAGCCAAGCTATCAGTTGG + Intergenic
1009189748 6:60616114-60616136 TCTGGAATCAAGTCCTCAGGGGG - Intergenic
1010630492 6:78192050-78192072 GCTTGAGCCACTTCCTCAGAGGG - Intergenic
1017522732 6:155216202-155216224 CCCTGTGCCATGTCCTCAGAAGG + Intronic
1017972839 6:159327998-159328020 CTCTGAGCCCAGACCTCAGGAGG - Intergenic
1018089177 6:160330730-160330752 TCATCAGCCAAGTCCTCTGGTGG - Intergenic
1019285138 7:219573-219595 CCTTCAGCCAAGGCCCCAGGAGG - Intronic
1021572306 7:22078469-22078491 CCTGGAGCCAAGGCTTCATGGGG + Intergenic
1022219782 7:28301898-28301920 CCTTGAGACAAATTCTCTGGAGG + Intronic
1026010928 7:66635577-66635599 CCTTGAACCAAGTGCCCAGGAGG + Intronic
1026016191 7:66672684-66672706 CCTTGAACCAAGTGCCCAGGAGG + Intronic
1029405432 7:100372032-100372054 CTTTCAGCCAGGTCCTCAGGTGG + Intronic
1029980355 7:104872787-104872809 GCTTCAGGCAGGTCCTCAGGTGG - Intronic
1033704745 7:143875953-143875975 CCTGGAGCCAACTCCCCAGTGGG + Intronic
1035228077 7:157444496-157444518 CCGGTAGCCAAGTCCACAGGTGG - Intergenic
1037163469 8:15799238-15799260 CCTTGAGACATGTGCTAAGGAGG - Intergenic
1037986540 8:23294070-23294092 GCTGGGGCCCAGTCCTCAGGAGG + Intronic
1038439240 8:27560150-27560172 GCTTGAGCCACGTCCTCTGCAGG - Intergenic
1039866582 8:41509930-41509952 CCTTGGGCCAGCTTCTCAGGTGG + Exonic
1041376808 8:57214443-57214465 CCTAGGGCCAACTGCTCAGGGGG - Intergenic
1042461995 8:69080507-69080529 CCTTGTGCCAAGGCTTCTGGAGG - Intergenic
1049213401 8:141396941-141396963 CCTTGAGCCAGGTACTCCTGTGG + Intronic
1055986372 9:82059297-82059319 CCTTGAGCCGTGTACTCAGCAGG - Intergenic
1056611912 9:88131104-88131126 CCTTGAGCCGTGTACTCAGCAGG - Intergenic
1057144525 9:92749147-92749169 CCTGGACCCCAGTCCTCAAGAGG - Intronic
1057160798 9:92886892-92886914 CCTTGAGCCATGTACTCAACAGG + Intergenic
1058776915 9:108293565-108293587 CCTTGAGCCAGAGTCTCAGGAGG - Intergenic
1058873277 9:109220704-109220726 CCTTGAGCAAAGTCTCCAGGAGG - Intronic
1059390021 9:113993236-113993258 GGGTGAGCGAAGTCCTCAGGAGG - Intronic
1061949104 9:133926314-133926336 CCCAGAGCCAAGTCCTAAGAGGG + Intronic
1062151519 9:135021613-135021635 CCTTGAGCCAAGGCCAGAGGAGG - Intergenic
1192822034 X:74656278-74656300 CCTGGAACGGAGTCCTCAGGGGG - Intergenic
1195037211 X:100981097-100981119 CTTGGAGCCAAGGACTCAGGGGG - Intronic
1198693998 X:139316233-139316255 CCTTGTTTCAAGTCTTCAGGAGG - Intergenic
1199474369 X:148229419-148229441 CCTTGTGCAAAGTCCTGAGCTGG + Intergenic
1201068922 Y:10126634-10126656 ACTTGAGACAACACCTCAGGTGG - Intergenic