ID: 1142152007

View in Genome Browser
Species Human (GRCh38)
Location 16:88516795-88516817
Sequence TTGTAGAAGGAGAAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 932
Summary {0: 1, 1: 0, 2: 4, 3: 71, 4: 856}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142151995_1142152007 16 Left 1142151995 16:88516756-88516778 CCCGGATCGCCCCAGCTGCTGCC 0: 1
1: 0
2: 2
3: 17
4: 266
Right 1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG 0: 1
1: 0
2: 4
3: 71
4: 856
1142152000_1142152007 -5 Left 1142152000 16:88516777-88516799 CCAGTTTTTCTTCTCTCTTTGTA 0: 1
1: 0
2: 10
3: 171
4: 3377
Right 1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG 0: 1
1: 0
2: 4
3: 71
4: 856
1142151997_1142152007 7 Left 1142151997 16:88516765-88516787 CCCCAGCTGCTGCCAGTTTTTCT No data
Right 1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG 0: 1
1: 0
2: 4
3: 71
4: 856
1142151998_1142152007 6 Left 1142151998 16:88516766-88516788 CCCAGCTGCTGCCAGTTTTTCTT 0: 1
1: 0
2: 6
3: 40
4: 390
Right 1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG 0: 1
1: 0
2: 4
3: 71
4: 856
1142151994_1142152007 20 Left 1142151994 16:88516752-88516774 CCTGCCCGGATCGCCCCAGCTGC 0: 1
1: 0
2: 1
3: 11
4: 197
Right 1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG 0: 1
1: 0
2: 4
3: 71
4: 856
1142151999_1142152007 5 Left 1142151999 16:88516767-88516789 CCAGCTGCTGCCAGTTTTTCTTC 0: 1
1: 0
2: 3
3: 33
4: 412
Right 1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG 0: 1
1: 0
2: 4
3: 71
4: 856
1142151996_1142152007 15 Left 1142151996 16:88516757-88516779 CCGGATCGCCCCAGCTGCTGCCA 0: 1
1: 0
2: 2
3: 20
4: 229
Right 1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG 0: 1
1: 0
2: 4
3: 71
4: 856
1142151993_1142152007 23 Left 1142151993 16:88516749-88516771 CCTCCTGCCCGGATCGCCCCAGC 0: 1
1: 0
2: 1
3: 21
4: 242
Right 1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG 0: 1
1: 0
2: 4
3: 71
4: 856

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142152007 Original CRISPR TTGTAGAAGGAGAAGGGGGA GGG Intronic
900364116 1:2303832-2303854 TTGTAGGAGTAGAAGCTGGAGGG - Exonic
900808990 1:4786941-4786963 TTGTGGAAGGGGCAGGGGTAGGG - Exonic
900979312 1:6037334-6037356 TTGCAGAAGGGGATGGGGGCTGG - Intronic
901228367 1:7628163-7628185 ATGGAGAAGGAGAAGGGAGCTGG - Intronic
901300469 1:8196664-8196686 TTGAAGAAGGAGACGGGGTGCGG + Intergenic
902192851 1:14775729-14775751 TTGAAGCAGGAGAAAGGGGCAGG + Intronic
902247053 1:15127940-15127962 TGGAAGAAGGACAAGGGGCATGG - Intergenic
902396207 1:16133605-16133627 TTCTGGAAGGAGAAGGGGTGGGG + Exonic
902896718 1:19484954-19484976 ATGGAGAAGGCAAAGGGGGAGGG + Intronic
902992977 1:20202583-20202605 TTGGAGAAGGGGAAGGAGAATGG - Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903467246 1:23560099-23560121 TTGCAGAAGGAGGAGGGAAAGGG + Intergenic
903656827 1:24954671-24954693 TTGGACAAGGACAAGGGCGAAGG - Intronic
903694892 1:25199390-25199412 GTGCAGAAGGAGAAGGTGGGAGG + Intergenic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
904010052 1:27384075-27384097 TAGGAGAAGCAGATGGGGGAAGG - Intergenic
904016880 1:27428521-27428543 TTGAAGCAGGTGGAGGGGGAGGG + Intronic
904679035 1:32216027-32216049 TAGGAGCAGGAGAACGGGGAGGG - Exonic
904893065 1:33793751-33793773 GTGTGGACGGAGAAGAGGGAGGG + Intronic
904920139 1:34000982-34001004 GGGGAGAAGGAGAAAGGGGAAGG + Intronic
905349689 1:37336874-37336896 TTGAAGAGGCAGAAGTGGGAGGG + Intergenic
905470529 1:38188297-38188319 TGGGAGGAGGAGGAGGGGGAGGG + Intergenic
905853821 1:41294022-41294044 TTGGAGATGGAGAAAAGGGAAGG + Intergenic
905920660 1:41716575-41716597 TTGTAGGAGGAGCAGTGGGAGGG + Intronic
905941658 1:41867923-41867945 TTTTGGAAGGGGAGGGGGGAGGG - Intronic
905980565 1:42222007-42222029 GAGGAGAAGGAGAAGGGGGAGGG + Intronic
906477933 1:46182333-46182355 ATGGAGAAGGAGCAGTGGGAGGG + Intronic
906615747 1:47231924-47231946 TTGCGTAAGGAAAAGGGGGAAGG + Intronic
906674730 1:47685092-47685114 TTGTAAAAGGAGTAGGTGGGAGG + Intergenic
906952290 1:50344726-50344748 TGCTGGATGGAGAAGGGGGAGGG + Intergenic
907330069 1:53664939-53664961 CTGTGGCAGGAGGAGGGGGAGGG + Intronic
907703540 1:56813319-56813341 TGGTAGAAGGCAAAGGAGGAAGG + Intronic
907990982 1:59582556-59582578 TAGGAGAAGGAGTAGAGGGAAGG - Intronic
908488614 1:64620093-64620115 TTAGAGAAGGAGAAGTGGGCTGG + Intronic
910332513 1:86090565-86090587 TGGTGGAAGTAGAAGGGGGTGGG - Intronic
910840680 1:91558426-91558448 TTGGGGAGGGGGAAGGGGGATGG - Intergenic
910850194 1:91642297-91642319 TTGTAGGAGGAGGAGTGGAAAGG - Intergenic
911591260 1:99750756-99750778 TTCCAGAAGGAGAAGAGGGAAGG + Intronic
911820315 1:102411265-102411287 AAGGAGAAGGAGAAGGGGGGTGG + Intergenic
912228633 1:107766232-107766254 AAGAAGAAGGAGGAGGGGGAAGG - Intronic
912498919 1:110108954-110108976 CTGCAGAGGGAGCAGGGGGATGG - Intergenic
912673785 1:111656999-111657021 TTGGGGGCGGAGAAGGGGGATGG - Intronic
912838205 1:113015471-113015493 TAGTAGATGAAGACGGGGGATGG - Intergenic
913069485 1:115286033-115286055 GTGTAGAAGGGGCAGGGGGAGGG + Exonic
913370088 1:118089039-118089061 TTCTAGTAGGAGGACGGGGAAGG + Intronic
913522578 1:119659784-119659806 TTGTAGAAGAGAGAGGGGGAGGG - Intronic
914326135 1:146618674-146618696 TTGTGGAAGGGGAAAGGGCATGG + Intergenic
914332058 1:146681142-146681164 TTGTAGATGGAGCAGAGGGAAGG - Intergenic
914351900 1:146847230-146847252 TTGAAGAAGGAAAAGGTGGGAGG - Intergenic
914942474 1:152035363-152035385 TTCTGGAAGGAAAAGGGGCAGGG - Intronic
915607161 1:156959822-156959844 GATTAGAAGGAGAAGGGAGACGG + Intronic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
918083776 1:181227988-181228010 ATGAAGAAGGAGAAATGGGATGG - Intergenic
918246337 1:182662936-182662958 CTGTAGATTGAGAATGGGGAGGG + Intronic
918703829 1:187637389-187637411 TTGGGGATGGAGAAGGAGGAGGG - Intergenic
918844627 1:189593921-189593943 TGGAAGAAGGTGAAGGGGAAAGG - Intergenic
919016767 1:192048510-192048532 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
919016798 1:192048676-192048698 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919973695 1:202597208-202597230 TTGGAGGGGGAGAAGAGGGAAGG + Intronic
920160838 1:203996665-203996687 TGGGAGAAGGAGAAGCAGGATGG + Intergenic
920273648 1:204787289-204787311 TGGTGGAAGGGGAAGGGGAAGGG - Intergenic
920579799 1:207095896-207095918 TGGCAGAAGGCAAAGGGGGAGGG - Intronic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
920713221 1:208315399-208315421 CTGTAGAAGCAGATGGGGAAAGG + Intergenic
921118846 1:212119265-212119287 ATTTAGGATGAGAAGGGGGAAGG + Intergenic
921229774 1:213057483-213057505 GGGTATAAGGAGTAGGGGGAAGG - Intronic
921269890 1:213458146-213458168 TTGTAGAGGGGGAAGGAGGATGG - Intergenic
921734505 1:218612007-218612029 GAGGAGAAGGAGAAGGGGGTAGG - Intergenic
922002463 1:221493904-221493926 TTGAGGAAGGAGAGAGGGGAAGG - Intergenic
922069070 1:222173549-222173571 TGGTGGAAGGGGAAGGGGAAGGG + Intergenic
922893100 1:229076791-229076813 GTGTAGAAGGGGAAGGAGGGAGG + Intergenic
922929813 1:229380330-229380352 TTGCAGAAGGAAAGAGGGGAGGG + Intergenic
923072434 1:230577883-230577905 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
923181083 1:231520430-231520452 TTGTAGAAAGAGGAGGGGAGAGG + Intergenic
923246577 1:232138152-232138174 TTGAAGCAGGAGTTGGGGGAAGG - Intergenic
923342091 1:233016357-233016379 GGGGAGGAGGAGAAGGGGGAGGG - Intronic
923576314 1:235161904-235161926 TTGCAGAAGGGGAAAGAGGAGGG - Intronic
924062030 1:240185029-240185051 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062045 1:240185086-240185108 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062053 1:240185115-240185137 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924063771 1:240203652-240203674 TTTTAGGAGGAGTATGGGGAGGG + Intronic
924101779 1:240611334-240611356 TGGTTGAAGGAGAAGAGAGAAGG - Intronic
1062846029 10:706285-706307 TTGGAGAAGGAGAAGAAGGGAGG - Intergenic
1063502737 10:6569812-6569834 GTGTTGAAAGAGAAAGGGGAAGG + Intronic
1063729636 10:8681611-8681633 GAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1064700955 10:18021142-18021164 TTGTATATGGTGAAAGGGGAGGG + Intronic
1064982635 10:21179781-21179803 TTGAAGACGGAGGAAGGGGAAGG + Intergenic
1065747418 10:28855015-28855037 AGGTAGAAGGATAAGGAGGAAGG - Intronic
1066203993 10:33169670-33169692 GTGCAGAAGGAAAAAGGGGAAGG + Intergenic
1067473825 10:46553705-46553727 TTGTGGAGGGGGAATGGGGAAGG - Intronic
1067521211 10:47007773-47007795 TTGAAGAAAGAAAATGGGGAGGG + Intergenic
1068317392 10:55364165-55364187 TGGCAGAAGGGGAAGGGGAAGGG - Intronic
1068430992 10:56931960-56931982 TTGTACAAGGGGAAGGATGAGGG + Intergenic
1068438367 10:57019568-57019590 TTGTGGAAGGGGCAGTGGGAGGG - Intergenic
1068538262 10:58264953-58264975 TGGGAGAATGAGTAGGGGGAAGG + Intronic
1069509590 10:69031886-69031908 TTGTAGACGGAAAAGGAGGAAGG - Intergenic
1070531333 10:77339848-77339870 AGGTAGAAAGAAAAGGGGGAAGG - Intronic
1070753423 10:78977114-78977136 TGGCAGAGGGAGAAGGGTGAAGG - Intergenic
1070902931 10:80046718-80046740 ATGTAGAAGAAGGAAGGGGAAGG + Intergenic
1071213333 10:83369750-83369772 TTAGAGAGGGAGAAGGGAGATGG - Intergenic
1071213355 10:83369974-83369996 TTAGAGAGGGAGAAGGGAGATGG - Intergenic
1071506381 10:86234187-86234209 TGGAGGAAGGAAAAGGGGGATGG - Intronic
1071579521 10:86756675-86756697 TTGGCGAAGGAGAAGGGAGGAGG + Exonic
1071821937 10:89288197-89288219 TTGTAGAAGGAGTTGGGGTTTGG - Intronic
1071827790 10:89342429-89342451 TTGTTTAAGGAGCAGGAGGATGG - Intronic
1071971901 10:90916067-90916089 GGGGAGAAGGAGGAGGGGGAGGG + Intronic
1072108022 10:92291830-92291852 TTGGGGAGGGGGAAGGGGGAGGG - Intronic
1072158343 10:92743919-92743941 TTGTAGGAGAAGTAGGGGGAGGG + Intergenic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072280307 10:93860121-93860143 TTGTTATAGGAGACGGGGGAAGG - Intergenic
1073348510 10:102802089-102802111 AGGTGGAAGGAGGAGGGGGAAGG - Intronic
1073446034 10:103580840-103580862 ATGTACAAAGAGAAGGGGGTAGG - Intronic
1073592141 10:104767654-104767676 GTGGAGAAGGGGAAGGGGAACGG - Intronic
1073779220 10:106818826-106818848 TTGTCAAAGGAGAAGGGGAAAGG - Intronic
1074217054 10:111395234-111395256 GAGCAGAAGGAGAAGAGGGAGGG + Intergenic
1074227326 10:111497546-111497568 GTTTAGAAGGAGGAGAGGGATGG + Intergenic
1074311437 10:112326428-112326450 TTACAGAAGGACAAGGGGGATGG - Intergenic
1074411839 10:113235403-113235425 TTGAACAAGGAGAATGGGGGTGG + Intergenic
1074581816 10:114726423-114726445 TGGTATAAGGCAAAGGGGGAAGG + Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1076121729 10:127941725-127941747 TTGTAGAAAGAGCAGGGGAATGG - Intronic
1076182575 10:128421973-128421995 GTCGAGAAGGAGAAGGGAGATGG + Intergenic
1076292585 10:129358875-129358897 TTTTGTAAGGTGAAGGGGGAAGG + Intergenic
1077107278 11:847716-847738 TTGTAGATGGGAAAGGGGGTGGG + Intronic
1077174236 11:1181426-1181448 GTGGAGAAGGAGAAGGTGGTTGG - Intronic
1077761544 11:5104910-5104932 GTGAGGAAGGAGAAGAGGGAGGG - Intergenic
1078479640 11:11664697-11664719 TTGAAGAGGTAGATGGGGGAGGG - Intergenic
1078558748 11:12352783-12352805 CTGTAAAAGGAGAGTGGGGAGGG + Intronic
1078612937 11:12837701-12837723 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1078811987 11:14777294-14777316 TTTGAGAAGGAGAAAGGGGGTGG + Intronic
1078869127 11:15327792-15327814 TCTTAGAGGGAGAAGGGGGATGG + Intergenic
1078936006 11:15950930-15950952 TGGGAGAGGGAGAAGGGGAATGG - Intergenic
1079559201 11:21801862-21801884 TTGTAGAGAGAGCAGGGGCAGGG + Intergenic
1080313531 11:30922940-30922962 TTGTTTAAGAAGAAGAGGGAAGG + Intronic
1080478368 11:32619863-32619885 AAGGAGAAGGAGGAGGGGGAGGG + Intronic
1080711986 11:34757649-34757671 GGGTAGTAGGAGAATGGGGATGG + Intergenic
1080806928 11:35662611-35662633 TTGGAGGAGGAGGAGGGAGAAGG - Intergenic
1081126248 11:39326646-39326668 TGGTGGAAGGGGAAGGGGAAGGG + Intergenic
1081982205 11:47274813-47274835 ATCTCTAAGGAGAAGGGGGAAGG + Exonic
1083160369 11:60850567-60850589 TTGGAGAAGGAGAGGAAGGAGGG - Exonic
1083573437 11:63772154-63772176 GGGAAGAAGGAGAAGGAGGAGGG + Intergenic
1083648398 11:64186262-64186284 ATGGAGCAGGTGAAGGGGGAGGG + Intronic
1083674743 11:64319057-64319079 GTTTGGGAGGAGAAGGGGGAAGG - Intronic
1083680203 11:64348287-64348309 TTGGAGCAGGAGAAGGTGGCTGG + Intronic
1083964482 11:66035029-66035051 TGGCACAAGGGGAAGGGGGAAGG + Intergenic
1084551689 11:69847303-69847325 GTGTAGAGGGAGAAGGGGCAGGG - Intergenic
1084681116 11:70666982-70667004 CTGTGGAAGGTGAAGGGGGTGGG + Intronic
1085565803 11:77512332-77512354 GGGTAGAAGGAGAAGAGGGTGGG - Intergenic
1085759973 11:79233433-79233455 TTGTGGAAGAGGCAGGGGGACGG + Intronic
1085857166 11:80188334-80188356 CTGGAGAAGGAAAAGGGGCAGGG - Intergenic
1085913996 11:80862872-80862894 ATGTAGAAGGAGAAGAGTCAGGG - Intergenic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086218853 11:84417412-84417434 TAGTACAAGGAGAAAAGGGAAGG - Intronic
1086427371 11:86699202-86699224 TTGTAAAATGAGTAGGAGGAGGG - Intergenic
1086457073 11:86969531-86969553 AGGAAGAAGGAGAAAGGGGATGG - Intergenic
1086499143 11:87434349-87434371 TTGTTGAAGGAGAAGAGAGGAGG + Intergenic
1086998927 11:93393024-93393046 AAGTAGAAGGAGGAGGAGGAGGG - Intronic
1087051982 11:93895654-93895676 AGCAAGAAGGAGAAGGGGGAGGG + Intergenic
1087213099 11:95463031-95463053 GTGTAGAAGGAAGAGGTGGAGGG + Intergenic
1087429785 11:98038365-98038387 GTGCACAAGGGGAAGGGGGAAGG + Intergenic
1087534458 11:99425496-99425518 TTGTAGAGGGACAAGGTGGTGGG + Intronic
1087691321 11:101323892-101323914 TTGTAGATAGGGAAAGGGGAAGG + Intergenic
1087939468 11:104077873-104077895 TTTTTGAAGGAGAAGGGAAAGGG - Intronic
1088047613 11:105472788-105472810 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1088339330 11:108745128-108745150 GAGTGGAAGGAGAAGGGAGAAGG - Intronic
1088856583 11:113760673-113760695 TTTTAGAGGGGGGAGGGGGAGGG - Intronic
1089064903 11:115655398-115655420 TTGTCGAAGAAGATGGGGTAGGG - Intergenic
1089105499 11:116000048-116000070 TTGTAGATTGAGAAGAGAGAGGG + Intergenic
1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG + Intergenic
1089346219 11:117793416-117793438 TTGTAGATGAAGAGAGGGGAGGG - Intronic
1089485636 11:118843832-118843854 TTGTAGAAGAAGCTGGGGAAAGG - Intergenic
1089548660 11:119252190-119252212 ATGTAAATGGAGTAGGGGGAGGG - Intronic
1089572451 11:119419521-119419543 CTGCAGAAAGAGAAGGGGGCCGG + Intronic
1089855616 11:121541795-121541817 TCGAAGAAGGAGAAGAGGGACGG - Intronic
1091140671 11:133231832-133231854 TTGTCAAAGGAGAAGGGGCAAGG + Intronic
1091872738 12:3908473-3908495 GTGGGGAAGGAGATGGGGGAAGG - Intergenic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1093084554 12:14852403-14852425 TGGGAGAAGGAGAAGGAGAAGGG - Intronic
1093115035 12:15198708-15198730 TTCTAGAAGGTGAAGGAGGCAGG - Intronic
1093233556 12:16578374-16578396 GGGTAGAGGGAGAAAGGGGAGGG + Intronic
1093523050 12:20072749-20072771 TTGTTGGAGGTGGAGGGGGAGGG + Intergenic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094350525 12:29519679-29519701 TTGTTGAAGTAAAAGGAGGAGGG + Intronic
1094535683 12:31320816-31320838 TTCAAGCAGGAGCAGGGGGAAGG + Intronic
1094772749 12:33684479-33684501 AGGGAGAAGGGGAAGGGGGAGGG - Intergenic
1094834482 12:34315889-34315911 TTGTAGAAGGAAAAAAGGCATGG - Intergenic
1095701172 12:45192713-45192735 TTATAGAATGATAACGGGGAGGG - Intergenic
1096062481 12:48713538-48713560 TTTTAGAAGGCGGAGGCGGAAGG + Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096524221 12:52201034-52201056 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1096528419 12:52228133-52228155 AAGAAGAAGGAGGAGGGGGAGGG - Intergenic
1096781054 12:53992333-53992355 CTATAGAAGGGGAAGGGGAAAGG - Intronic
1097527733 12:60759382-60759404 TTGAAGATGGAGAAGGGGGCAGG - Intergenic
1097616641 12:61891682-61891704 TAGGAGGAGGAGAAGGAGGAGGG + Intronic
1097786406 12:63765028-63765050 TTGTTGAAAGAGAAGAAGGAAGG + Intergenic
1097860148 12:64510736-64510758 GTCTTGAAGGAGAATGGGGAGGG + Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098371418 12:69764311-69764333 TTGTATATGGTGAAGGGGGATGG + Intronic
1098495882 12:71135285-71135307 AAGAAGAAGGAGGAGGGGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1099616432 12:84941522-84941544 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1099669273 12:85669580-85669602 TTGTGGAAGGATAGGAGGGAAGG - Intergenic
1099853437 12:88134259-88134281 TTGTTGGAGGAGAGGGAGGATGG - Intronic
1099959182 12:89380414-89380436 GAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1100001047 12:89835550-89835572 TTGAAGAAGGAGGCAGGGGATGG + Intergenic
1100216889 12:92459983-92460005 GTGTAGTTGGAGAAAGGGGAAGG - Intergenic
1100308014 12:93369046-93369068 TGGCAGAAGGAGAAGGAGAAGGG - Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1100604811 12:96142925-96142947 TTGGGGAAGGAGAAGAGAGAGGG + Intergenic
1100760816 12:97804826-97804848 TTGTGGAAAGAATAGGGGGAGGG + Intergenic
1100779397 12:98008009-98008031 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1101358823 12:104007294-104007316 ATCTGGAAAGAGAAGGGGGAGGG - Intronic
1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG + Intronic
1101959013 12:109234082-109234104 TTGGAGAAGGAGGAGGGGCTGGG + Intronic
1102166747 12:110813000-110813022 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1102426497 12:112848111-112848133 TTGAAGAAGGGGCAGGGGGAGGG + Intronic
1102436107 12:112925286-112925308 TTGTATGAGGAAAAGGGGGAGGG - Intronic
1102597347 12:114002953-114002975 TTGTATTTGGAGATGGGGGAGGG - Intergenic
1102647199 12:114411393-114411415 TTATTTAAGGAGAAGGGGCATGG + Intergenic
1102822962 12:115923841-115923863 GAGGAGAAGGAGAAGGGGGTGGG - Intergenic
1103340758 12:120220001-120220023 TGGGAGGAGGAGAAGGAGGAAGG + Intronic
1103371575 12:120423329-120423351 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1103426022 12:120834593-120834615 TTGCAGAAGGAGTATGGCGACGG - Intronic
1103438380 12:120944742-120944764 TGGAAGAAGGAGAAGGCGCACGG - Intergenic
1103516779 12:121513437-121513459 TTCCAGAGGGCGAAGGGGGAAGG + Intronic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1103858857 12:123995550-123995572 TTGGAGAAGGAGAATGGAGGTGG + Intronic
1104548342 12:129732603-129732625 TTGTGGAAGGGGAAGTGGGAGGG - Intronic
1105841454 13:24257175-24257197 ACGTAGAAAGAGAAGGGGAATGG - Intronic
1106771514 13:32965284-32965306 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1107104958 13:36633215-36633237 TTATTGAAGGACAAGGTGGAGGG + Intergenic
1107405586 13:40109576-40109598 ACGAAGAAGGAGAAGGGAGAGGG + Intergenic
1107629863 13:42332447-42332469 GTATAGAAGGAGAAGAAGGAGGG + Intergenic
1107795463 13:44046927-44046949 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108787150 13:53918564-53918586 TTGTATATGGAGAAGAGGAAGGG + Intergenic
1108837023 13:54563343-54563365 TTGTAGAATAAGAGGGGGAAAGG + Intergenic
1109860126 13:68187540-68187562 TTATTGAAGGAGGATGGGGAGGG - Intergenic
1109940797 13:69361373-69361395 TTGAAGACTCAGAAGGGGGAAGG + Intergenic
1110229478 13:73153380-73153402 TTGTTGAAAGAGAAGGAGGGAGG - Intergenic
1111353791 13:87070318-87070340 GAGAAGAAGGAGAAGGGGAAGGG - Intergenic
1111388739 13:87562923-87562945 ATGTAGAAGTAGAAGAGAGAAGG + Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1112098167 13:96158247-96158269 CTGTAGAGGGAGATGCGGGAAGG + Intronic
1112958810 13:105095846-105095868 AGGTAGAAAGAGAAGGGTGAGGG + Intergenic
1113025734 13:105938916-105938938 TTGAAGAATGAGAAAGGTGAAGG - Intergenic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1113266804 13:108627919-108627941 TTGTATTAAGAGAAGGGGGTAGG + Intronic
1114050800 14:18918868-18918890 GGGTAGATGGAGAAGGGAGAGGG - Intergenic
1114111759 14:19483054-19483076 GGGTAGATGGAGAAGGGAGAGGG + Intergenic
1114260113 14:21030517-21030539 GGGGTGAAGGAGAAGGGGGAGGG - Exonic
1114441129 14:22748902-22748924 CTGTCAAAGGAGAAGGGGCACGG + Intergenic
1114552995 14:23544846-23544868 TGGGAGAAGGAGAAGTGGAATGG - Intronic
1114669521 14:24401408-24401430 TTGGAGAAGGAGGACAGGGAAGG + Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115529362 14:34312802-34312824 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
1115724489 14:36198463-36198485 TACTAGAAGGGGAAGGGGAATGG + Intergenic
1115742146 14:36399630-36399652 TGGTAGAAGGAGAGGGAAGAAGG - Intergenic
1116753922 14:48922037-48922059 TAATAGAAGTAGAAGGGAGAAGG - Intergenic
1116898435 14:50339496-50339518 TTGAAGAAGGAAGAGAGGGAGGG + Intronic
1117232851 14:53739438-53739460 TTGAGGAAGGAGAAGGAGCAAGG + Intergenic
1117232963 14:53741042-53741064 TTGAAGAAGAAGAAGGAGCAAGG - Intergenic
1117517965 14:56521377-56521399 TTGGAGAGTTAGAAGGGGGAGGG - Intronic
1118033371 14:61839878-61839900 TTGTGGAGGGGAAAGGGGGAGGG + Intergenic
1118405670 14:65421354-65421376 TGGTAGAGGTGGAAGGGGGAAGG + Intronic
1119533032 14:75376483-75376505 TGGTGGAAGGTGAAGAGGGAGGG - Intergenic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1120281456 14:82443669-82443691 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1120717216 14:87852794-87852816 GTATAAAAGGAGAAGGGGCAAGG - Intronic
1120736651 14:88060552-88060574 TTTAAGAAGGAAAAAGGGGAGGG - Intergenic
1120763155 14:88304074-88304096 TGGGAGAGTGAGAAGGGGGATGG + Intronic
1121080403 14:91103335-91103357 GGCTAAAAGGAGAAGGGGGAAGG - Intronic
1121572873 14:94960752-94960774 TTCTGGAAGGAAAAGTGGGAAGG - Intergenic
1121747109 14:96305596-96305618 TTTTAGCCGGAGAAGTGGGAGGG + Exonic
1122047769 14:99035834-99035856 TTGCAGAAGGAGAAGGGGCCGGG + Intergenic
1122100105 14:99401789-99401811 TTGAGGAAGGAGATGAGGGAAGG - Intronic
1124694643 15:31853814-31853836 TTGTTGAAGAAGAAGGATGAGGG - Intronic
1124996500 15:34728068-34728090 ATTTAGATGGAGAATGGGGAGGG - Intergenic
1125525408 15:40370931-40370953 GTGCAGCAGGAGAAGGAGGATGG + Exonic
1126129302 15:45325021-45325043 TAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1126951554 15:53887175-53887197 GTGTGGAAGGAGAAGGGTTATGG + Intergenic
1127905661 15:63374050-63374072 TGGTAGGAGGTGGAGGGGGAAGG - Intronic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128446294 15:67764259-67764281 TTGTATAAGGAGAAGGGAACAGG + Intronic
1128557470 15:68641485-68641507 AGGGAAAAGGAGAAGGGGGAGGG + Intronic
1128568513 15:68716829-68716851 ATGTAGCAGGAGATGGGGGGAGG + Intronic
1128736070 15:70054684-70054706 TTCTGGAGGGAGAAGGGGCAGGG + Exonic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1128935859 15:71745977-71745999 TTGAAGAAGAACAAGGGGAAAGG + Intronic
1129057596 15:72832274-72832296 TTGTAGAATGTAAGGGGGGAGGG + Intergenic
1129064905 15:72893839-72893861 ATGTAGAAAGAGATGGGGGCTGG - Intergenic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1129076098 15:72997327-72997349 TTCTGGAAGGAGAGAGGGGAAGG + Intergenic
1129156140 15:73719394-73719416 CCGTGAAAGGAGAAGGGGGAGGG - Intergenic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129506245 15:76083832-76083854 TGGTAGAAGGAAAGGAGGGAGGG + Intronic
1129693964 15:77730073-77730095 TTGTGGGGGGAGTAGGGGGAAGG + Intronic
1130226006 15:82058867-82058889 GAGAGGAAGGAGAAGGGGGAAGG - Intergenic
1130687676 15:86053433-86053455 TTGTAGAAAGAGAAGGCTGTAGG + Intergenic
1130725372 15:86433383-86433405 TTCTAGAAGGAGGAAGGTGAAGG + Intronic
1130733740 15:86526839-86526861 TTGGAGAAACAGAAGGGGGTTGG + Intronic
1131202770 15:90414212-90414234 TGGGAGATGGAGAAGGGGGCGGG + Intronic
1131853403 15:96566534-96566556 CTGTAGAAGGAGAGGGGGCTGGG - Intergenic
1131931994 15:97453084-97453106 TTGTTGAATGAGAAGGGGCTGGG + Intergenic
1131947063 15:97635204-97635226 GGGTGGAAGGAGAAGGAGGAGGG - Intergenic
1131967523 15:97859909-97859931 GCGTAGGTGGAGAAGGGGGATGG - Intergenic
1132510344 16:337784-337806 TTGCTGGAGGAGAAGGGGCATGG + Intronic
1133392753 16:5422766-5422788 ATGGAGAGGGAGAAGGGAGAGGG + Intergenic
1133463620 16:6008634-6008656 TTGAAGATGGAGCAGAGGGAAGG + Intergenic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133912700 16:10080377-10080399 TTGCAGAAAGCGAAGGTGGAAGG + Intronic
1133928957 16:10216653-10216675 TAGAAGAAGGGGAAGGGGGAGGG + Intergenic
1133971421 16:10570904-10570926 TGGAAGAAGAAGAAGGGCGAGGG + Intronic
1134398663 16:13889078-13889100 CCGGAGAAGGAGAAAGGGGAGGG - Intergenic
1134636737 16:15798396-15798418 TTTTAGAAGGAGGAGAGGTATGG + Intronic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1134800174 16:17077002-17077024 GTGGAGAAGGTAAAGGGGGAAGG - Intergenic
1134810323 16:17161507-17161529 TTGGAGAAGGACTGGGGGGATGG - Intronic
1135192886 16:20369111-20369133 TTTGAGGAGGAGAAGGGAGATGG - Intronic
1135671852 16:24382261-24382283 GTGGAGAAGGAGGAGGGGGAGGG - Intergenic
1135866235 16:26105016-26105038 TTGAAGAAGGATAAGGAGGTGGG - Intronic
1135963432 16:27016469-27016491 TGCTAGAAGAAGAAGGGGAAGGG - Intergenic
1136144951 16:28311078-28311100 GTGTGGAAGGAGAAGAAGGAGGG + Intronic
1136619672 16:31419985-31420007 TTTTAGAGGGAGAGGGGGAAAGG - Intronic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137911570 16:52383266-52383288 TTGTTGGAGGAGGAGGGGAAGGG - Intergenic
1138705610 16:58912172-58912194 TGGCAGAAGGCAAAGGGGGAGGG - Intergenic
1138962061 16:62038827-62038849 TTGGAGAAGGAGTTGGGGGGAGG + Intergenic
1139477615 16:67210504-67210526 TTGCAGAAGGAGAACTGGGCGGG + Exonic
1139982133 16:70868306-70868328 TTGAAGAAGGAAAAGGTGGGAGG + Intronic
1140001492 16:71029776-71029798 TTGTAGATGGAGCAGAGGGAAGG + Intronic
1140007432 16:71092272-71092294 TTGTGGAAGGGGAAAGGGCATGG - Intronic
1140145172 16:72300067-72300089 AGGTAGAAAGAGAAGGGGGATGG - Intergenic
1140686472 16:77438303-77438325 TTGTAAGAGGAGCAGAGGGAGGG + Intergenic
1140705238 16:77622657-77622679 TTGGAGACTGAGAAAGGGGAAGG - Intergenic
1141162481 16:81638605-81638627 TTCTCCAAGGAGAAGGGAGAGGG - Intronic
1141845116 16:86603371-86603393 AGGAAGAAGGAGGAGGGGGAAGG - Intergenic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1142167213 16:88598594-88598616 TTGAAAAACGAGAAGGGAGAAGG - Intronic
1142388820 16:89784707-89784729 TTGGGGAAGGGGAAGGGGAAGGG + Intronic
1142759274 17:2033956-2033978 TTGTGGGAGGGAAAGGGGGAAGG - Intronic
1143111272 17:4554354-4554376 TGGGAGAAGTTGAAGGGGGAAGG - Intronic
1143361137 17:6372220-6372242 TGGAAGAGGGAGAAGGGAGAAGG + Intergenic
1143729078 17:8870166-8870188 TGGCAGAAGGAGGAGGAGGAAGG - Intergenic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144136467 17:12300192-12300214 TTGGAGTAGGAGATGGGGGTAGG - Intergenic
1144161364 17:12563002-12563024 TCCTAGAAGGAGAAGGAGTATGG - Intergenic
1145240319 17:21237126-21237148 TTGAAGAAGGAGATGTGGGCTGG - Intergenic
1145240859 17:21240511-21240533 TTGGAGAATGAGGAAGGGGACGG + Exonic
1145262360 17:21361970-21361992 TGGTAGAAGAAGAAAGAGGAGGG - Intergenic
1145855851 17:28156564-28156586 TTGTGGGAGGGGGAGGGGGATGG + Intronic
1146614567 17:34344618-34344640 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1147387387 17:40090442-40090464 GTGTGGAAGGAGGAGGTGGATGG - Intronic
1147882243 17:43661395-43661417 TGGTGGAAGGAGAACGGGGTGGG + Exonic
1148249594 17:46064625-46064647 TTGGAGAGGGAGGAGGAGGAGGG - Intronic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1150367709 17:64604977-64604999 TTGGACAAGGAGAAAAGGGAGGG - Intronic
1150666090 17:67139918-67139940 ATGTAGCAGGAGATGGGGGTTGG - Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150927731 17:69551310-69551332 TTGTAGGTGGAGAAGGGTAATGG + Intergenic
1151660379 17:75515484-75515506 TTGGAAAAGGAGAAGGAGAAAGG - Exonic
1152302032 17:79500640-79500662 CGGGAAAAGGAGAAGGGGGATGG - Intronic
1152336731 17:79703140-79703162 TAGAGGGAGGAGAAGGGGGAGGG - Intergenic
1152467578 17:80474801-80474823 TTGTAAAAGGGGAGGGGGGGGGG - Intronic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1153043571 18:836063-836085 TTGTAGAAGTAGAAGATGGGAGG + Intergenic
1153350392 18:4074398-4074420 TTTTAGAAGGAAATGAGGGAGGG + Intronic
1153632772 18:7088032-7088054 TTTTAGAAGAAGAAGTGGGTTGG + Intronic
1153915038 18:9737865-9737887 TTTTAAAAGCAGAAGGGGGTGGG - Intronic
1154484738 18:14864819-14864841 TGGTAGATGGAGAAGGGAAAGGG - Intergenic
1155377555 18:25176968-25176990 AGGCAGAAGGAGAAGGGGGCTGG - Intronic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1156841909 18:41618964-41618986 TTGGAGAAGGGGATGGGGGCTGG - Intergenic
1157191471 18:45585769-45585791 ATGCAGAGGGAGAAGGGGGCAGG - Intronic
1157237605 18:45979188-45979210 AAGAAGAAGGAGAAGGGAGAGGG - Intergenic
1157246012 18:46056059-46056081 CTGTAGAGAGAGAAGGGAGAGGG - Intronic
1157476279 18:48025512-48025534 GTGAAGATGGAGAAGGGGAAGGG - Intergenic
1158254449 18:55530306-55530328 TTTTAGAAAGAGTAGGGGGTTGG + Intronic
1158292779 18:55960047-55960069 TTGTTGGAAGAGAAGGGAGACGG + Intergenic
1158300257 18:56044039-56044061 TTGTAGCAGGAGGATGGGAATGG - Intergenic
1158576593 18:58643861-58643883 TTGTAGAAGGAGTTGGGGTTTGG + Intergenic
1158864873 18:61628634-61628656 TTGTGGTAGGAGCAAGGGGACGG + Intergenic
1159743002 18:72196504-72196526 CTGAATAAGGAAAAGGGGGAGGG + Intergenic
1160342657 18:78102597-78102619 TTGTGGAGCGTGAAGGGGGAGGG + Intergenic
1160373387 18:78392202-78392224 TTGTAGAAGGGGAACGAGAAAGG + Intergenic
1161254463 19:3299672-3299694 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1161403794 19:4080919-4080941 GAGGAGGAGGAGAAGGGGGAGGG + Intergenic
1161509739 19:4663730-4663752 TTGTAGAATGAGGATGGGGTGGG - Intronic
1162084836 19:8242246-8242268 TTTAAGAGGGAGAAGAGGGAAGG + Intronic
1162549744 19:11351767-11351789 TTGTAGAAGGGGAGGGGAAAAGG + Intronic
1162843534 19:13373600-13373622 TTGGAGAAGGAGAGGGGAGGTGG - Intronic
1162964120 19:14148018-14148040 TTGGAGACAGAGAAAGGGGAAGG + Exonic
1163117659 19:15197967-15197989 TAATAGAAGGGGAAGGGGCAGGG + Intronic
1163171187 19:15532344-15532366 GTGGAGGAGGAGGAGGGGGATGG - Intronic
1163627992 19:18401919-18401941 TTTTATAAGGAGCAGAGGGATGG + Intergenic
1163779630 19:19239632-19239654 GAGTGGAAGGAGGAGGGGGAGGG - Intronic
1164592134 19:29512906-29512928 TTGGAGAAGGAGGAAGGAGAGGG + Intergenic
1164696578 19:30249343-30249365 GAGGAGAAGGAGGAGGGGGAGGG + Intronic
1164718701 19:30415250-30415272 CAGGAGGAGGAGAAGGGGGAGGG - Intronic
1165194850 19:34093880-34093902 TGGCAGAAGGCAAAGGGGGATGG + Intergenic
1165369359 19:35394442-35394464 TTGGAGAAGGTGCAGGGGAAGGG + Intergenic
1165817987 19:38654747-38654769 TTGTTTATGGAGAAAGGGGAGGG - Intronic
1165913541 19:39244331-39244353 ATGGAGAAGGAGAAGGTGAAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166151760 19:40880251-40880273 GTGTGGAGGGAGAAGGGGGTTGG + Intronic
1166182103 19:41116384-41116406 TGGTGGAAGGATAAGGAGGAGGG + Intronic
1166652133 19:44582654-44582676 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1166674947 19:44734657-44734679 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1167608262 19:50493215-50493237 AGGTAGAAGGAGAATGGGGAGGG + Intergenic
1167671719 19:50857348-50857370 AGGAGGAAGGAGAAGGGGGAAGG + Intronic
1167702107 19:51054956-51054978 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1168251574 19:55145314-55145336 AAGGAGAAGGAGAAGGGGAAGGG + Intronic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
1168418444 19:56184439-56184461 TTGAAGAAGGAGATGGGGTTGGG - Intronic
1168434416 19:56305964-56305986 TGGGGGCAGGAGAAGGGGGAGGG + Intronic
925123962 2:1440530-1440552 TTGTTGAAAGAGAAGGGGGCAGG + Intronic
925150576 2:1612110-1612132 TTAGAGGAGGAGAAGTGGGAAGG - Intergenic
925791630 2:7494396-7494418 TTGTAGAAGAATATGGGAGAAGG + Intergenic
926277677 2:11417034-11417056 TTGTAGGAGAAGATGTGGGATGG + Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
927503768 2:23599954-23599976 CTGCAGAATGAAAAGGGGGATGG - Intronic
927866177 2:26589153-26589175 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
928441919 2:31299382-31299404 TTGTAGTAGGAGCAGGGGTTTGG - Intergenic
928619182 2:33071539-33071561 TTGGAGCAGGAACAGGGGGAAGG + Intronic
928761110 2:34584081-34584103 TTGGAGACTGAGAAGTGGGAAGG + Intergenic
929792502 2:45034054-45034076 TAGTAGGAGGAAAAAGGGGATGG + Intergenic
929872184 2:45768483-45768505 TTACAGAAGGAAAAGAGGGAAGG - Intronic
930222213 2:48756125-48756147 TTGGTGAAAGAGAAGGGGAAAGG - Intronic
930364409 2:50421324-50421346 ATTTAGAAAGTGAAGGGGGAAGG - Intronic
930395216 2:50814375-50814397 TTGGGGAATGAGAAGGGGTAAGG - Intronic
930967511 2:57348190-57348212 TTGTAAAAGGTGTAGGGGGCAGG + Intergenic
931236180 2:60414143-60414165 TTGGCAAAGGAGGAGGGGGAAGG - Intergenic
931471275 2:62539944-62539966 CTGTAGAATGAGAAGAGGGGAGG + Intergenic
931826301 2:66004196-66004218 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
931862726 2:66373274-66373296 TAGTAGAAGGGGAAGAGAGAGGG - Intergenic
932018037 2:68053109-68053131 TTTTAGAAGGAGTATGTGGAAGG - Intronic
932408965 2:71534060-71534082 TTTTACAGGGAGGAGGGGGAAGG + Intronic
932819369 2:74886538-74886560 TGGTGGAAGGAGAAGAGGGGCGG + Exonic
933190393 2:79327795-79327817 ATGCAGAAGGGGCAGGGGGATGG + Intronic
933274934 2:80273626-80273648 GTGTGGCAGGAGAAGGGTGATGG - Intronic
933475625 2:82786453-82786475 ATGGAGAAAGAGAAGGGGGGCGG + Intergenic
934731614 2:96662054-96662076 GTGTGGAAGAAGAAGGGGCATGG + Intergenic
934851937 2:97707189-97707211 TGTTAGAAGGAGGAGGGTGAGGG + Intergenic
935277057 2:101484181-101484203 CTAGGGAAGGAGAAGGGGGAAGG - Intergenic
936409084 2:112238094-112238116 TTGTAGAGGGAGCTGGAGGATGG - Intronic
936832835 2:116669860-116669882 AAGGAGAAGGAGAAGAGGGAAGG - Intergenic
937130905 2:119512334-119512356 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
937388298 2:121457401-121457423 TGGCAGAAGGAGAAGGGGAGAGG - Intronic
937542407 2:122974219-122974241 TTGTGGGAGGGGGAGGGGGAAGG - Intergenic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
937686814 2:124706853-124706875 GAGGAGAAGGAGAAGGGGAAAGG + Intronic
938236406 2:129709945-129709967 TTGAAAAAGGAGAAGGTGAAAGG - Intergenic
939872875 2:147544450-147544472 TTGTAGCAGGAGAAAGGGGGTGG - Intergenic
939918717 2:148081782-148081804 ATGTAGAATAAGAATGGGGAAGG - Intronic
940137219 2:150451603-150451625 AAATAGAAGGAGAAGGAGGAGGG - Intergenic
940987383 2:160062669-160062691 TTGGGGAAGGAGGAGGAGGAGGG + Intergenic
941038196 2:160590516-160590538 GAGGGGAAGGAGAAGGGGGAGGG - Intergenic
941038226 2:160590594-160590616 GAGGAGAAGGGGAAGGGGGAGGG - Intergenic
941089829 2:161161167-161161189 TTCTAGAAGTAGAAAGGGGGAGG + Intronic
941141103 2:161782891-161782913 TTCCAGAAGGAGAAGAGAGAAGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941963744 2:171280074-171280096 CTGTACAAGACGAAGGGGGAGGG + Intergenic
942210424 2:173664232-173664254 TTGAAGAAGGCGGAGGAGGAGGG - Intergenic
942604655 2:177677600-177677622 TTGAAGAAGGAGAGGGTGGAAGG + Intronic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
942782451 2:179661183-179661205 TGGTAAAAGGAAAATGGGGAAGG + Intronic
942913734 2:181277543-181277565 TTCTCGAAGGAGAAGTGGGATGG + Intergenic
943007922 2:182409144-182409166 ATGTAAAAGGAGAAGGGAGGAGG - Intronic
943061766 2:183047380-183047402 TTGTAGAAGGAGTTGGGGTTTGG - Intergenic
943218704 2:185075782-185075804 ATGTAGAATGAGGAGGAGGAGGG + Intergenic
943566908 2:189526780-189526802 GTGTTGATGGAGAAGGAGGAGGG - Intergenic
943921538 2:193713269-193713291 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
944654635 2:201865353-201865375 TGGTGGATGGAGAAGGTGGAGGG - Intronic
945148951 2:206767765-206767787 TTGAAGAAGGAGAGAAGGGAAGG + Intronic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945435344 2:209811020-209811042 TTTAAGAAGGAGAAATGGGATGG + Intronic
945814979 2:214593701-214593723 TTTTAAAAGGAGAATGAGGAAGG + Intergenic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946162005 2:217841164-217841186 CTGGAAAGGGAGAAGGGGGAAGG + Intronic
946440297 2:219689396-219689418 TTGTGGAAGGAGAGGGAGGACGG - Intergenic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
947783639 2:232794134-232794156 CTTAAGAAGGAAAAGGGGGATGG - Intronic
947929441 2:233951461-233951483 TTGTACAAGGAGTAAGAGGAAGG - Intronic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948227021 2:236319109-236319131 ATGAAGAAGGAGGAGGGGCATGG - Intergenic
948344339 2:237282679-237282701 AAGGAGAAGGGGAAGGGGGAGGG + Intergenic
948539004 2:238672376-238672398 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
948558568 2:238835269-238835291 AGGGAGAAGGAGAAGGGGAAGGG - Intergenic
948558594 2:238835350-238835372 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
948760312 2:240186171-240186193 TTGGTGGAGGAGAAGCGGGATGG + Intergenic
949066491 2:241993823-241993845 TTGCAGAAGGAGATGGGGTGGGG + Intergenic
1168760085 20:344627-344649 CTGTAGAAGGCGAAGGGGAAGGG - Intergenic
1168833105 20:858220-858242 TGGTAGCTGGAGATGGGGGAAGG - Intergenic
1168859424 20:1035336-1035358 TTCTAGAATGAGACGGGTGAAGG + Intergenic
1169178318 20:3539314-3539336 TTTTAGGAGGAGAAAGGGTAGGG + Intronic
1169258441 20:4117551-4117573 TGGCAGAAGGGGAAGGGGGAGGG + Intergenic
1169495671 20:6112759-6112781 TTGAAGAAACAGAAGGGGAAAGG + Intronic
1169690856 20:8330074-8330096 TTGCAGAAGAATCAGGGGGATGG - Intronic
1169808234 20:9581237-9581259 AGGTAGAAGAAGTAGGGGGAAGG - Intronic
1170579238 20:17685244-17685266 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1170641253 20:18155366-18155388 TAGTGGCTGGAGAAGGGGGATGG - Intronic
1170664858 20:18378050-18378072 ATGAAGAAGGAGATGGGGGAAGG + Intergenic
1171121911 20:22575856-22575878 AGGTAAAAGGAGATGGGGGATGG - Intergenic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1172038694 20:32028779-32028801 AGGAAGAAGGAGAAGGGGGGTGG + Intronic
1172122207 20:32605046-32605068 TGGTAGAATGAGAAGGTTGATGG - Intronic
1172183806 20:33019344-33019366 TTGAAGAAGGATAAGGGAAAGGG - Intronic
1172474680 20:35227369-35227391 TTCAAGCTGGAGAAGGGGGAGGG + Intronic
1172474684 20:35227375-35227397 CTGGAGAAGGGGGAGGGGGAGGG + Intronic
1172884588 20:38222627-38222649 TTGCAGAGGGAGAGTGGGGATGG - Intronic
1173375228 20:42476985-42477007 TGGTGGAAGGAGAAGGGGGAAGG - Intronic
1173375422 20:42478203-42478225 GGGTGAAAGGAGAAGGGGGAAGG + Intronic
1173694386 20:44996196-44996218 TTCTAGAAGGAGACAGGGGTTGG - Intronic
1173989906 20:47293941-47293963 TGGCAGCAGGAGAAGGGGGGTGG - Intronic
1174573998 20:51524109-51524131 TTCTGGAAAGAGAAGGGGGAAGG + Exonic
1175128995 20:56775112-56775134 CAGGAGAAAGAGAAGGGGGAGGG - Intergenic
1175257193 20:57654643-57654665 TAATAGAAGGAGAAGTGAGAGGG - Intronic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1175661431 20:60816323-60816345 TAATAAAAGGAGAAGGGGAAGGG - Intergenic
1176796586 21:13374656-13374678 TGGTAGATGGAGAAGGGAAAGGG + Intergenic
1177926696 21:27225790-27225812 TGGTAGAAACAGAAGGAGGAGGG + Intergenic
1178029047 21:28504226-28504248 TTGCATAAGGAGGTGGGGGATGG - Intergenic
1178155326 21:29846692-29846714 TTAAAGAATGAGAAGGGAGAAGG + Intronic
1178226277 21:30722866-30722888 TTGTAAAAAGAGAATGAGGATGG - Intergenic
1178584721 21:33862480-33862502 TGGGAGAAGGAGAAGAGGGAAGG + Intronic
1178914864 21:36700525-36700547 TCGTAGAAAGAAAAGGAGGAAGG - Intronic
1178982144 21:37273570-37273592 GTGGAGAAGGAGGAGGGGGGAGG + Intergenic
1179173361 21:38990200-38990222 AAGTAGAAGGAGAAGGGAAAAGG + Intergenic
1179278961 21:39917467-39917489 TGGTAGAGGGAGAAGCTGGAAGG + Intronic
1179515963 21:41907103-41907125 TTGCAGCAGGAACAGGGGGAGGG + Exonic
1180469277 22:15641243-15641265 GGGTAGATGGAGAAGGGAGAGGG - Intergenic
1181183949 22:21088188-21088210 TTGTAGGAGGTGGAGGGGGGAGG - Intergenic
1181716938 22:24737862-24737884 GTGTAGAAAGAGAAGGGGGCCGG + Intronic
1182229403 22:28825809-28825831 ATATATTAGGAGAAGGGGGAAGG + Intergenic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1182865001 22:33596663-33596685 TTGTTGGAGGAGAAGAGGAAGGG + Intronic
1182886410 22:33777672-33777694 AAGGAGAAGGAGAAGGGGAAGGG + Intronic
1183325096 22:37187123-37187145 TAGCAGCAGGAGAAGGGGGCTGG + Intronic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
1184468030 22:44680382-44680404 TAGTGGAAGGAAAGGGGGGATGG + Intronic
1185093917 22:48795517-48795539 TGGTAGAAGGAGGAAGGGGCAGG - Intronic
1185363749 22:50424933-50424955 TTGAAGAAGGAAAAGGGGCTGGG - Intronic
949127947 3:469091-469113 GAGGAAAAGGAGAAGGGGGACGG - Intergenic
949366267 3:3284995-3285017 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
949507872 3:4743732-4743754 TTGTTGAGGGGGAAGGGGGAGGG + Intronic
949551631 3:5116634-5116656 ATGTGGATGGAGAAGGAGGAAGG - Intergenic
949920931 3:9000018-9000040 TTGGAGCAGGAGTAGAGGGAGGG - Intronic
952285380 3:31963262-31963284 TTATATAAGGAGAAGGGGATGGG - Intronic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952504906 3:33998856-33998878 TTGTAGAAGAAGAGGAGTGAGGG + Intergenic
953344263 3:42161810-42161832 GTCTTGAAGGAGATGGGGGAGGG + Intronic
953419371 3:42742605-42742627 TTGTAAAAGGGAGAGGGGGAGGG - Intronic
953578402 3:44131362-44131384 TTGTAGAAGTGTAAAGGGGAAGG - Intergenic
953909035 3:46882654-46882676 TCGTAGAGAGAAAAGGGGGAGGG + Intronic
954212871 3:49108332-49108354 TTAGAGAAGGAGAAGCGGCAAGG + Intronic
954616048 3:51969078-51969100 TTGCAGAAGGAGGAGTGGGTGGG + Exonic
954740821 3:52749080-52749102 TTGCAGAAGGGGAAGAGGGGAGG + Intronic
954839475 3:53497678-53497700 TAGTAGTAGTAGTAGGGGGAGGG + Intronic
956012095 3:64842801-64842823 CTTTAGAAGGAAAAGGTGGAAGG + Intergenic
956592264 3:70927274-70927296 GAGTAGGAGGAGAAGGGGAAAGG - Intergenic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
957867978 3:86049689-86049711 TAGCAGAAGGCAAAGGGGGAAGG + Intronic
958114342 3:89196020-89196042 TGGGAGAAGGAGGAAGGGGAAGG - Intronic
958717979 3:97809789-97809811 TTATAGAAGGAAAAGGAAGAAGG + Intergenic
959077068 3:101760473-101760495 TTGTAGAGAGAGCAGGGGAAGGG + Intronic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960659657 3:120043850-120043872 GTTTAGATGGAGAAGGAGGAGGG - Intronic
961222512 3:125212084-125212106 TGGTAGAAGGAGGAAGGGGGAGG + Intronic
961416592 3:126763329-126763351 TTGTTGAAAGAGGAGGGGGAGGG - Intronic
961599204 3:128046096-128046118 CTTGAGAAGGAGAAAGGGGAGGG - Intergenic
961792248 3:129384673-129384695 TTGGAGAAGGTGGAGGGGTAGGG - Intergenic
961846725 3:129771181-129771203 TTGGATAAGGAGATTGGGGATGG + Intronic
961935986 3:130584444-130584466 TTCTAGAATGAGAATGAGGAGGG - Intronic
961941034 3:130637102-130637124 TTGGAGGAGGGGGAGGGGGAGGG - Intronic
962246397 3:133797923-133797945 TAGAAGAGGGAGAAGGGGAAGGG + Intronic
962254507 3:133861113-133861135 CTGCAGAAGGGGAAGGGGGCTGG + Intronic
963003085 3:140701544-140701566 GTCCAGAAGGAGAAGAGGGAGGG - Intergenic
963111639 3:141693513-141693535 TTGTAGAAGGAGTTGGGGTTTGG + Intergenic
963498210 3:146095897-146095919 CTGTGGAGGGAGAGGGGGGAGGG - Intronic
963861355 3:150313683-150313705 TTGGAGAGGGAGAAGGGGTGAGG + Intergenic
964412048 3:156408031-156408053 TTGTGGAAGGTGACGGGGGAGGG + Intronic
964762423 3:160146850-160146872 TTGGAGGAAGAGAAGGTGGAGGG - Intergenic
964966292 3:162497158-162497180 TGGTGGAAGGGGAAGGGGAAGGG + Intergenic
965018328 3:163191020-163191042 GTGTAGTATGAGAAGGGAGATGG - Intergenic
965076004 3:163977303-163977325 TAAAAGAAGGAGAAGGGGGCTGG - Intergenic
965301827 3:167014490-167014512 ATGTAGAATGAGAAATGGGAAGG - Intergenic
965311680 3:167135923-167135945 TTGTTTAAGGAGGAGAGGGAAGG + Intergenic
965327470 3:167324890-167324912 TTGTAGAAGAAGAAGTTGGAAGG - Intronic
965398938 3:168194977-168194999 TTGTAGTGGGGGCAGGGGGAGGG - Intergenic
965969131 3:174532174-174532196 TGGGGGAAGGAGAAGGGGAAGGG + Intronic
966185220 3:177221062-177221084 GTCTAGAAGAGGAAGGGGGAAGG - Intergenic
966982888 3:185153699-185153721 GGGTGGGAGGAGAAGGGGGAGGG - Intergenic
967517765 3:190390570-190390592 TTGTTGAAAGAGAAGGGAGCCGG - Intronic
967789766 3:193534768-193534790 TCCTAGAAGGAGAGGGGAGAGGG + Intronic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
968846093 4:3042260-3042282 TTGTACGAGGGGAAGGGGAAGGG + Intergenic
968889196 4:3358969-3358991 GTGTAGGAGGAGAGGGAGGAGGG - Intronic
970320183 4:14867800-14867822 TACTAGAGGGAGAAGGTGGAAGG + Intergenic
970740958 4:19237101-19237123 TTGTTGCTGGAGAAGGGAGAAGG - Intergenic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971305117 4:25473295-25473317 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
971655250 4:29336006-29336028 TTATAGAAGAAAAAGGAGGAAGG - Intergenic
972455607 4:39251329-39251351 TTGTATAAGGTGTAAGGGGAAGG - Intronic
972804054 4:42509362-42509384 CTGTTGAGGAAGAAGGGGGATGG + Intronic
973663262 4:53130575-53130597 GTGTAGAGGGAGAGGGGAGATGG - Intronic
973673650 4:53241749-53241771 GTGCAGCAGGAGGAGGGGGAGGG - Intronic
974556843 4:63461651-63461673 AGAGAGAAGGAGAAGGGGGAAGG + Intergenic
975308571 4:72877349-72877371 TGGGAGAGGGGGAAGGGGGAGGG - Intergenic
975481386 4:74884426-74884448 TGGAAGAGAGAGAAGGGGGAGGG - Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
975785986 4:77888853-77888875 TTGGAGTAGGGGACGGGGGAGGG - Intronic
976006030 4:80431543-80431565 GAGAAGAAGGAGAAGGGGAAGGG - Intronic
976069505 4:81224972-81224994 TTGAAGATGGAGGAAGGGGAGGG - Intergenic
976205618 4:82620772-82620794 TTGGACAATGAGAAGGGAGATGG + Intergenic
976406966 4:84670856-84670878 TTGAAGATGGTGATGGGGGAGGG + Exonic
976569781 4:86594618-86594640 CTGTAGAAGGAGCCTGGGGAGGG - Exonic
976571541 4:86617566-86617588 TGCTGGAAGGGGAAGGGGGAGGG - Intronic
976589472 4:86834833-86834855 TGGTAGAAGGCAAAGGGGAAGGG + Intronic
976739736 4:88345816-88345838 TTGTAGAAGGAGTTGGGGTTTGG + Intergenic
977371413 4:96141823-96141845 ATGTAGAAGGAGAAAGGGAGAGG - Intergenic
977627145 4:99199906-99199928 TGGTAGAAGGCAAAGTGGGAGGG + Intergenic
978870231 4:113566923-113566945 TTGTAGTAGTTGAAGGAGGAGGG - Intronic
980835708 4:138189296-138189318 TTGTGGAATGAGAAGGAGCATGG + Intronic
981032095 4:140135906-140135928 AGGTTGAAGGAGAAGGGGGAGGG - Intronic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981430235 4:144648759-144648781 GAGGAGAAGGGGAAGGGGGATGG + Intronic
981655212 4:147105086-147105108 CTGTAAAAGGAGAAGGGTAAGGG - Intergenic
981676912 4:147353255-147353277 TTGTAAAAGAAACAGGGGGATGG - Intergenic
982097455 4:151935791-151935813 TTGTAGATGGAGAAGGGAAAGGG + Intergenic
983192757 4:164772221-164772243 AGGAAGAGGGAGAAGGGGGAGGG + Intergenic
983763229 4:171440437-171440459 GTGTAGGGGCAGAAGGGGGATGG - Intergenic
983820311 4:172184809-172184831 AGGTAGAAGGACAAGGGGGCTGG + Intronic
983884803 4:172968499-172968521 TTGTAGAGGGAGGAGGGGAGAGG - Intronic
983905169 4:173174145-173174167 GTGTGGGGGGAGAAGGGGGATGG - Intronic
984035097 4:174657407-174657429 TTGTATAAGGAGAAGGAAAAAGG + Intronic
984189552 4:176589019-176589041 TAGTAGAAGGAGAAAGAGGAAGG + Intergenic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
984725162 4:183013450-183013472 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
984911437 4:184676929-184676951 AGGGAGAAGGGGAAGGGGGAAGG - Intronic
985494710 5:198012-198034 GGGCAGAAGGAGAAAGGGGATGG - Exonic
985690136 5:1304316-1304338 AAGGAGAAGGAGAAGGGAGAAGG - Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986185575 5:5433347-5433369 TTTGAGAAGGTGAAGGGGAATGG - Intronic
986221730 5:5774769-5774791 GAGGAGAAGGAGGAGGGGGAGGG - Intergenic
986221734 5:5774775-5774797 AAGTAGGAGGAGAAGGAGGAGGG - Intergenic
986291997 5:6407589-6407611 CTCTGGAAGGAGAAGAGGGAAGG - Intergenic
986482652 5:8204350-8204372 TAGCAGAAGGTGAAGGAGGAAGG - Intergenic
986618456 5:9644493-9644515 TTCAAGAAGGAGAAGGTTGAAGG + Intronic
987615573 5:20269705-20269727 TTGTAGACTTAGAAGGGTGAAGG + Intronic
988987005 5:36630157-36630179 TGCTAGTGGGAGAAGGGGGAGGG + Intronic
989252094 5:39329172-39329194 CTGTAGAAGTAAAAAGGGGAGGG - Intronic
989688704 5:44116776-44116798 TTGTAGAAGGAGTTGGGGCTTGG + Intergenic
991020178 5:61972069-61972091 TTGTGGAAGGAGGTGAGGGAGGG - Intergenic
991036402 5:62131940-62131962 AGGGAGCAGGAGAAGGGGGATGG - Intergenic
991264548 5:64701528-64701550 TTTTAGAAGGGGCTGGGGGAAGG + Intronic
992453208 5:76891820-76891842 TGGGAGAGGGAGGAGGGGGAGGG + Intronic
992596610 5:78353563-78353585 TTGTAGGAGGACAAGGGTGGAGG + Intergenic
992707124 5:79407721-79407743 TCATAGAAGGAGAAGAGAGAAGG + Intronic
993090373 5:83418615-83418637 GTGTAGGGGAAGAAGGGGGAGGG + Intergenic
993666190 5:90699410-90699432 TTGTTGAAGAAATAGGGGGAAGG + Intronic
993716128 5:91277355-91277377 GAGGAGGAGGAGAAGGGGGAGGG + Intergenic
994014798 5:94952793-94952815 TTGGAGCATGAGAAGGGTGAAGG - Intronic
994757188 5:103808982-103809004 AGGTAAAAGGAGAAGGGAGAAGG - Intergenic
994816267 5:104591773-104591795 GTGGAGAAGGAGGAGGGGCAGGG - Intergenic
994988996 5:106974658-106974680 TTCTGCAAGGAGAGGGGGGATGG + Intergenic
995098599 5:108270955-108270977 GTGGAGAAGGAGAGGGGGAAAGG - Intronic
995683784 5:114748864-114748886 TTCTAGAAGGACAAGTGTGATGG + Intergenic
995735854 5:115298386-115298408 GAGAAGAAGGAGAAGGGAGAAGG + Intergenic
996587580 5:125107739-125107761 TAGAAGGAGGAGAAGGAGGAGGG - Intergenic
997262392 5:132475073-132475095 GTGGAGATGGAGGAGGGGGAAGG + Intronic
997267140 5:132501427-132501449 TTGGAGAAAGAGAAGGGTGCAGG + Intergenic
997399691 5:133592781-133592803 TGGTAGAAGGTGAAAGGGAATGG - Intronic
997513205 5:134466847-134466869 TTGGAGATGGAGACGGGGGTGGG - Intergenic
997893427 5:137695066-137695088 TTGGAAGAGGGGAAGGGGGAAGG - Intronic
998400294 5:141845322-141845344 GTGGAGGAGGAGCAGGGGGAGGG - Intergenic
999195002 5:149775819-149775841 GTGGAGAAAGAGAAGGGGGTAGG - Intronic
999273762 5:150314588-150314610 TTGGAGGAGGAGAAGAGGGCTGG - Intronic
999829440 5:155304758-155304780 TTGCAGAAGGCTAAGGGGCAGGG - Intergenic
999831190 5:155321910-155321932 ATGAACAAGGAGATGGGGGAGGG - Intergenic
1000194280 5:158942900-158942922 TAGTAGAAGAGGGAGGGGGAAGG + Intronic
1000194291 5:158942949-158942971 TAGTAGAAGAGGGAGGGGGAAGG + Intronic
1000253224 5:159514571-159514593 TTGCACAAGGAAAAGTGGGAGGG + Intergenic
1000977112 5:167777073-167777095 TTACAGGAGTAGAAGGGGGAGGG + Intronic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001822425 5:174720742-174720764 TTGCAGAGTGAGAATGGGGAAGG - Intergenic
1002355186 5:178622275-178622297 TTATATAAGGGGAAGGGGGAAGG - Intronic
1002397314 5:178968153-178968175 TTGTGGTAGGAAAAGGGAGAGGG - Intergenic
1002996931 6:2295278-2295300 TTGGAGACTGACAAGGGGGAGGG + Intergenic
1003000520 6:2328014-2328036 TCTCAGAAGAAGAAGGGGGAAGG - Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003725958 6:8764313-8764335 TTTTAGAAGGACCAGGAGGAAGG - Intergenic
1003812993 6:9805229-9805251 AGGGAGATGGAGAAGGGGGAGGG - Intronic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG + Intergenic
1004784741 6:18955121-18955143 ATGAAGAAGGAGAAGGGGCTGGG - Intergenic
1004947041 6:20626968-20626990 CTGTAGACGGGGAAGGGAGAAGG + Intronic
1005229258 6:23681342-23681364 TTATAGAAGAGGAAGGGGGATGG - Intergenic
1005492971 6:26363719-26363741 TTGGGGAGGGGGAAGGGGGAGGG + Intergenic
1006215270 6:32436724-32436746 GTGCAGAAGGAAAAGGGGGTAGG + Intergenic
1006652437 6:35562814-35562836 CTGGAGAAGGAGAAAGGGAAGGG + Intergenic
1007371608 6:41429872-41429894 TTGAAGAGGGAGAGGGGAGAGGG - Intergenic
1007392904 6:41560900-41560922 TTGTGGAAGGAGAAAAGAGAAGG - Intronic
1007694910 6:43725769-43725791 TGGGAGAAGCAGAACGGGGAAGG + Intergenic
1007748252 6:44056484-44056506 CTGAAGAAGGAGAAAGGAGATGG + Intergenic
1007829220 6:44625484-44625506 TGGGAAAAGGAGATGGGGGAAGG - Intergenic
1007957454 6:45930318-45930340 TTGTAGAAGGAGAAGAGGAAAGG + Intronic
1008517316 6:52330350-52330372 TTGGAGAAAGTGAAGGGTGAGGG + Intergenic
1008728389 6:54450101-54450123 TTCCAAAAGGAGAAGGGAGAAGG + Intergenic
1008777021 6:55052173-55052195 TTGTAGAAGGACAAAAAGGAGGG - Intergenic
1008879035 6:56362084-56362106 TGGTAGTAGGAGATGGTGGACGG - Intronic
1009437649 6:63636195-63636217 GTGTGGAAGGGGATGGGGGAGGG - Intronic
1010073603 6:71773390-71773412 TTGGAGAAGCAGAAGGGGAAAGG - Intergenic
1010586499 6:77662775-77662797 TTGTAGAAGGTGATGGGGTTTGG + Intergenic
1010704786 6:79094977-79094999 TTGTAGAAGAACATGTGGGATGG - Intergenic
1010941562 6:81924802-81924824 GTGGAGAAGGAGGAGGTGGAAGG + Intergenic
1011401972 6:86973158-86973180 ATTTAAAAGGAGAAGGTGGAGGG - Intronic
1011771285 6:90676225-90676247 TTGGGGAGGGAGAAGGAGGATGG + Intergenic
1012494379 6:99818516-99818538 AAGAAGAAGAAGAAGGGGGAGGG - Intergenic
1012660767 6:101887721-101887743 TGGGAGAGGGGGAAGGGGGAAGG + Intronic
1013787771 6:113800904-113800926 GTGTAGGTGGAGAAGGGGGACGG + Intergenic
1014059431 6:117053096-117053118 TTGTGGAGGGAGATGGGAGAGGG + Intergenic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014276461 6:119395267-119395289 TTATAGAGGGAGAAAGGGAAGGG + Intergenic
1014294200 6:119598407-119598429 AAGGAGAAGGAGAAGGGGAATGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015275285 6:131377741-131377763 TTGAAGAAGGAGAAAGGGGAGGG - Intergenic
1015575348 6:134665427-134665449 TGTTAGAAGGGGGAGGGGGAAGG + Intergenic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1016466107 6:144327203-144327225 TGGGAGGAGGAGAAGGAGGAGGG + Intronic
1017339568 6:153305201-153305223 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1017339582 6:153305249-153305271 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1018402058 6:163433291-163433313 TTGAAGCCTGAGAAGGGGGAAGG + Intronic
1018928795 6:168225922-168225944 GGGGAGAAGGAGAAGGAGGAGGG - Intergenic
1019750968 7:2729565-2729587 ATGCAGAAGCAGAAGAGGGAGGG - Exonic
1020463769 7:8453140-8453162 AAGTAGAAGGAGAGGGGGAAAGG + Intronic
1020508315 7:9020452-9020474 TTGTAAAAGGGAAAGGGGGGAGG + Intergenic
1021211978 7:17864776-17864798 GAGAAGGAGGAGAAGGGGGAGGG + Intronic
1021289380 7:18823989-18824011 AAGAAGAAGGAGAAGGGGAATGG + Intronic
1021464656 7:20928614-20928636 TTGTAGAAGGAGCAGTGAAATGG + Intergenic
1021614526 7:22488319-22488341 TTGGGGAAGGAGAAGAGGAAGGG + Intronic
1021737948 7:23657457-23657479 GTTTAGAAGGAGAAGGAGTAGGG - Intergenic
1021809466 7:24389441-24389463 TTGTGTTGGGAGAAGGGGGAAGG - Intergenic
1021972696 7:25981176-25981198 TGGAAGAAGGAGAAGGGAGAGGG + Intergenic
1022140735 7:27491423-27491445 TTGGAGAAGGAGAGGAAGGAGGG + Intergenic
1022274416 7:28841799-28841821 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1022636599 7:32142178-32142200 AGGCAGAAGGAGAAGGGGGAAGG + Intronic
1022670301 7:32449363-32449385 AGGAAGAAGGAGAAGGGGAACGG + Intergenic
1023734494 7:43222925-43222947 TTCAAGAAGGAGATGTGGGATGG - Intronic
1024049530 7:45610034-45610056 TTGTTGGAGCAGTAGGGGGAGGG + Intronic
1025176920 7:56806848-56806870 GTGTAGGAGGAGGAGGGGGTGGG - Intergenic
1025694872 7:63769538-63769560 GTGTAGGAGGAGGAGGGGGTGGG + Intergenic
1026163815 7:67892472-67892494 CTTTAGAATGAGAGGGGGGAGGG - Intergenic
1026231721 7:68489725-68489747 TTTAAGAGGGAGAAGGGTGATGG + Intergenic
1026255052 7:68703921-68703943 TTCTTGAATGAGAAGGGTGAGGG + Intergenic
1026501759 7:70948684-70948706 TGGTGGAAGGTGAAGGGGGCCGG - Intergenic
1026994570 7:74606977-74606999 TTGGAGCAGGGGAAGGGGGTGGG - Intergenic
1027564948 7:79780072-79780094 GTGGAGTAGGGGAAGGGGGAAGG - Intergenic
1030149959 7:106394438-106394460 TTGTAGAGGGAGGAGGGGCAAGG - Intergenic
1031157967 7:118133573-118133595 TTGTGGTAGGAGTAGGGAGATGG - Intergenic
1031595108 7:123640723-123640745 GAGGAGAAGGGGAAGGGGGAAGG + Intergenic
1031704408 7:124962855-124962877 TTGTAGAAGGAGTTGGGGTTTGG + Intergenic
1032204115 7:129846828-129846850 TAGTAGAAGGAGAAAGGGGATGG - Intronic
1032729237 7:134621646-134621668 TTGTGGAGGTAAAAGGGGGAAGG - Intergenic
1032940673 7:136786436-136786458 TGGTAGGAGGAGAAGGGTGAGGG - Intergenic
1032962040 7:137046859-137046881 CAGAAGAAGGAGGAGGGGGAAGG + Intergenic
1033184184 7:139210862-139210884 TGGTGGAAGGTGAAGGAGGAAGG + Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1033975228 7:147092920-147092942 CTGTGGAAGGAAAAGGGGTATGG + Intronic
1034053726 7:148012218-148012240 TGGTAGAAAAAGAAGGGGAAGGG - Intronic
1034354418 7:150441860-150441882 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1034400253 7:150857305-150857327 TTGTGGGAGGAGAAGAGGGGCGG - Exonic
1034552419 7:151830057-151830079 TTCTAGATGGAGAAATGGGATGG + Intronic
1034584619 7:152078173-152078195 TCCTAGAAGGAGAAGAGGGAGGG + Intronic
1035160337 7:156945188-156945210 TTGGAGGAGGAGGAGGGGGAGGG - Intergenic
1035722057 8:1799318-1799340 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1035760446 8:2064777-2064799 GAGGAGAAGGAGGAGGGGGATGG - Intronic
1036295213 8:7529236-7529258 AAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1036327357 8:7791782-7791804 AAGGAGGAGGAGAAGGGGGAGGG + Intergenic
1036463493 8:8974735-8974757 TTGGGGAGGGTGAAGGGGGAGGG - Intergenic
1037099578 8:15027770-15027792 TTAAAGAAAGAGAAGGGAGAGGG + Intronic
1037809037 8:22075310-22075332 AAGAAGAAGAAGAAGGGGGAGGG - Intronic
1038483660 8:27918869-27918891 GGGAAGAAGGAGAAGGAGGAGGG + Intronic
1038913304 8:31991757-31991779 TTGGGGAAGGAGGAGGGAGAAGG - Intronic
1039089430 8:33812690-33812712 TTGTCAGAGGAAAAGGGGGATGG + Intergenic
1041267607 8:56080332-56080354 AAGAAGAAGGAGGAGGGGGAGGG + Intergenic
1041267616 8:56080364-56080386 GAGGAGAAGGAGAAGGCGGAAGG + Intergenic
1041886933 8:62820607-62820629 TTGTAGAATGAGAAGACCGAAGG + Intronic
1041910813 8:63086481-63086503 TGATGGAAGGAGAAGGGAGAGGG - Intergenic
1042130429 8:65582486-65582508 AAGAAGGAGGAGAAGGGGGAGGG + Intergenic
1042267219 8:66921237-66921259 TTGGAGAATTAGAAGGGGGTGGG + Exonic
1042730905 8:71933942-71933964 TGGTATAAGAAGAAGGGGAAGGG - Intronic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043219694 8:77645022-77645044 CTATGGAAGGAGAAGGGGAAGGG - Intergenic
1043385588 8:79744634-79744656 AAGTAAAAGGAGAAGGGGGATGG + Intergenic
1043583816 8:81744315-81744337 TTGTAGTAGGAGAAAGGGTTGGG + Intronic
1044191679 8:89326453-89326475 TTTGACAAGGACAAGGGGGAAGG - Intergenic
1044633925 8:94303679-94303701 TTGGTGAAGGAGAAGGGTGCAGG - Intergenic
1044878997 8:96702766-96702788 TTACAGAAGGAGAAAGGGGAGGG - Intronic
1044932020 8:97260133-97260155 CAGGAGAAGGAGGAGGGGGAGGG + Intergenic
1045824432 8:106380110-106380132 TGGGAGAAGGGGAAGGGGAATGG - Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046022038 8:108676675-108676697 TTCTAGTTTGAGAAGGGGGAAGG - Intronic
1046289306 8:112136133-112136155 GTCTAGAAGGAGAAGAGGAAAGG - Intergenic
1046522505 8:115343447-115343469 TTGCAGAAGGAAAATGGGGAAGG - Intergenic
1046860573 8:119086693-119086715 TTATAGAAGGGGAAGAAGGAAGG + Intronic
1046885192 8:119359059-119359081 ATGTGGAAGGAGAAGGGGAGGGG + Intergenic
1047254828 8:123207112-123207134 GTGATGGAGGAGAAGGGGGAAGG - Intronic
1047537346 8:125731957-125731979 CTGGAGACGGAGACGGGGGAGGG + Intergenic
1047640903 8:126820878-126820900 TTGGAGAGGAAGAAGGGAGATGG + Intergenic
1047702565 8:127464240-127464262 TAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1048156192 8:131955777-131955799 TTGCAGAAGGAGAAGAAGGAGGG - Exonic
1048417559 8:134243633-134243655 GAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1048417576 8:134243693-134243715 GAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1048628166 8:136210019-136210041 TGGTGCAAGGAGAAGGGGGTTGG - Intergenic
1048696272 8:137031659-137031681 AATTAGGAGGAGAAGGGGGAGGG - Intergenic
1048941146 8:139401954-139401976 GAGAAGAAGGATAAGGGGGATGG - Intergenic
1049093182 8:140532326-140532348 TTCTGGAAGGGGAAGGGGCAGGG - Intronic
1049122521 8:140751811-140751833 TTGTAGCAGGACAAGGGGAATGG + Intronic
1049589096 8:143447687-143447709 TGGCAGAAGGTGAAGTGGGAGGG + Intronic
1049644129 8:143728490-143728512 TTAGGGAAGGAGAAGGGGGTTGG + Exonic
1049739882 8:144233533-144233555 TCGTAGAGAGAGAAGGTGGATGG - Intronic
1050053973 9:1632585-1632607 TTGGAGAAGGGGCAGGGGCAGGG - Intergenic
1050203486 9:3173894-3173916 TCGTGGAAGGAGAAGGAGGAGGG + Intergenic
1050358547 9:4805390-4805412 AAGAAGAAGGAGAAGGGGAAGGG + Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051508117 9:17847333-17847355 TTGAACCAGGTGAAGGGGGAGGG - Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1052976791 9:34417057-34417079 AAGAAGAAGGAGAAGGGGAAGGG - Intronic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053233819 9:36434323-36434345 TGGGGGAAGGAGGAGGGGGAGGG + Intronic
1053453739 9:38214713-38214735 TAGAGGAAGGAGAAGGGGAAAGG + Intergenic
1055307371 9:74943688-74943710 TCTTAGAAGCAGAATGGGGATGG - Intergenic
1055378037 9:75671795-75671817 TGGTTGAAGAAGAAGAGGGAAGG + Intergenic
1055580807 9:77704541-77704563 CTGTTGGAGGAGTAGGGGGAAGG + Intergenic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1056462795 9:86824518-86824540 TTCTAAAAAGAGAAGGGGAAGGG + Intergenic
1056479064 9:86982512-86982534 TTGAAGATCGAGAAAGGGGAAGG + Intergenic
1057113136 9:92493156-92493178 TTGTAAGAAGAAAAGGGGGATGG + Intronic
1057453526 9:95187320-95187342 ATGAAGAGGGAGAAGGGAGAAGG - Intronic
1057455413 9:95204699-95204721 TTTTAGATGGAGTAGGGGTAAGG - Intronic
1057474727 9:95388704-95388726 ATGAAGAGGGAGAAGGGAGAAGG + Intergenic
1058276494 9:103048039-103048061 TTAGAGAATCAGAAGGGGGAGGG + Intergenic
1058508611 9:105692162-105692184 TTGTAGGAGGAAATGGAGGATGG - Intergenic
1058690248 9:107514305-107514327 TTGTAGAGACAGCAGGGGGAGGG - Intergenic
1058829102 9:108799455-108799477 TGGTAGAGGGAGAAAGGGAAAGG - Intergenic
1059889588 9:118786548-118786570 TGGTGGCAGGAGAAGGGGGTTGG + Intergenic
1060709678 9:125846641-125846663 ATGTAGAAGGAGAAAGCTGATGG - Intronic
1061723221 9:132566637-132566659 CTTTAGAAAGAGAAGGGAGATGG - Intronic
1061854809 9:133436264-133436286 TTGGAGAAGGAGGAAAGGGAGGG - Intronic
1061947392 9:133916386-133916408 TTGTAGAAAGGGAAGGTGGTGGG + Intronic
1062033419 9:134372195-134372217 TTGTAGAGGCAGAAGGGCGTAGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062564527 9:137158269-137158291 AGGGAGAAGGAGCAGGGGGAAGG + Intronic
1062638367 9:137503445-137503467 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638374 9:137503464-137503486 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638381 9:137503483-137503505 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638393 9:137503521-137503543 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1185504972 X:625227-625249 GAGTAGAAGGAGGAGGAGGAGGG - Intronic
1185891028 X:3822279-3822301 TTTTAGCCTGAGAAGGGGGAGGG + Intronic
1185896132 X:3860695-3860717 TTTTAGCCTGAGAAGGGGGAGGG + Intergenic
1185901251 X:3899121-3899143 TTTTAGCCTGAGAAGGGGGAGGG + Intergenic
1185934851 X:4244794-4244816 TTGAAGACGGAAAAGGGAGAGGG + Intergenic
1186471165 X:9823094-9823116 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1186471169 X:9823113-9823135 AGGGAGAAGGAGAAGGGAGAAGG - Intronic
1186471172 X:9823126-9823148 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1187023826 X:15411781-15411803 TGGTGGAAGGAGGAGCGGGAGGG - Intronic
1187082096 X:16001421-16001443 TCTCTGAAGGAGAAGGGGGATGG - Intergenic
1187298517 X:18026175-18026197 TTTCAGAAAGAGAAGGGGTAGGG - Intergenic
1187309067 X:18123133-18123155 TGGTACAAGGAGAAGGGGAGTGG - Intergenic
1187530507 X:20092338-20092360 TGGTAGGGGGAGGAGGGGGAAGG - Intronic
1187805030 X:23110432-23110454 TTGTGGGAGGGAAAGGGGGAGGG - Intergenic
1187824738 X:23323660-23323682 TGGAAGAAGAAGAAGGAGGAGGG - Intergenic
1187843793 X:23515444-23515466 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1188237187 X:27744828-27744850 TGGCAGAAGGAGAAGGGGAGCGG - Intronic
1188513346 X:30959897-30959919 TGGTAGAAGGTGAAGGGGAAGGG + Intronic
1188788796 X:34382426-34382448 TTGTGGTGGGAGAAGGGGAAGGG + Intergenic
1189233975 X:39473736-39473758 TTGGAGATGGAAAAGGGGGAGGG + Intergenic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1189601741 X:42634138-42634160 TTGAAGAAAGAGAAGGAAGATGG + Intergenic
1189684398 X:43548814-43548836 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1189778436 X:44491059-44491081 TTGCAGGAAGAGAAGGGGGATGG - Intergenic
1190072741 X:47292462-47292484 GTGGAGAAGGAGGAGGGGCAGGG + Intergenic
1190171006 X:48111633-48111655 ATGGAGAAGGAGCAGGGGCAGGG + Intergenic
1190559723 X:51675070-51675092 TTGGAGAAGGAGAACAGGGTGGG - Intergenic
1190564568 X:51718251-51718273 TTGGAGAAGGAGAACAGGGTGGG + Intergenic
1191667044 X:63714234-63714256 CTGAAGAAGGAGTAGGGGGCAGG - Intronic
1192029638 X:67495485-67495507 TGGCAGAAGGGGAAGGGGAAGGG - Intergenic
1192058408 X:67797531-67797553 TTGGAGACTAAGAAGGGGGAGGG + Intergenic
1192549006 X:72038960-72038982 TTGTAGAAGCAGAAGTGGATTGG + Intergenic
1192556906 X:72097422-72097444 TTTTTGGGGGAGAAGGGGGAGGG + Intergenic
1192884445 X:75321994-75322016 TTGGAGACTGAGAAGGGGTAGGG - Intergenic
1193054878 X:77139307-77139329 TAGTAGAAGGAGAACTGGGTTGG + Intergenic
1193360249 X:80572501-80572523 TGGTGGAAGGAGAAGAGGGGCGG - Intergenic
1193405491 X:81096014-81096036 TTGGAGATGCAGAAGGGGTAAGG + Intergenic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193574170 X:83179058-83179080 TTGGAGAATAATAAGGGGGATGG - Intergenic
1193992356 X:88323612-88323634 TTGTAGTATCAGAAGAGGGAAGG - Intergenic
1194946506 X:100074663-100074685 TTGGAGAATTGGAAGGGGGAGGG + Intergenic
1195422816 X:104694572-104694594 CTTTAGAAGGTGAAGGGGAATGG + Intronic
1195703557 X:107722712-107722734 TTGTAGATGGACAATAGGGAGGG - Intronic
1196544672 X:116947770-116947792 CTGAAGATGGTGAAGGGGGAAGG + Intergenic
1196577377 X:117335179-117335201 TTGCAGAGGGAGGAGGGAGAAGG - Intergenic
1197472826 X:126883695-126883717 TTGTACAAGAAAAAGGGGGCGGG - Intergenic
1197884087 X:131200114-131200136 TTGTGAAAGGAGAGGGGAGAAGG + Intergenic
1198219390 X:134585846-134585868 ATGTACAAGGAGTTGGGGGAGGG + Intronic
1198605417 X:138332051-138332073 TTGTGGAAGGAGAAGAGGCCAGG - Intergenic
1199166268 X:144679203-144679225 CTGAAGATGGCGAAGGGGGAAGG - Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199862742 X:151816441-151816463 TTGGAGAAGGAATAGGTGGAAGG + Intergenic
1200010001 X:153113745-153113767 TTTGAGAACCAGAAGGGGGAAGG - Intergenic
1200029599 X:153286177-153286199 TTTGAGAACCAGAAGGGGGAAGG + Intergenic
1200379711 X:155822203-155822225 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1200379719 X:155822227-155822249 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1200397738 X:156001119-156001141 TTCTAGACAGGGAAGGGGGATGG - Intronic
1200491400 Y:3827990-3828012 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1201300269 Y:12498827-12498849 GAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1201972465 Y:19812597-19812619 TTGAAGAAGTAGAATCGGGAAGG - Intergenic
1202110802 Y:21417196-21417218 ATGTAGTAGGAGAAGAGAGAAGG + Intergenic