ID: 1142155020

View in Genome Browser
Species Human (GRCh38)
Location 16:88528995-88529017
Sequence ATGGCTCCTGTACCCGGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142155020_1142155025 -1 Left 1142155020 16:88528995-88529017 CCCCGGCCGGGTACAGGAGCCAT 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1142155025 16:88529017-88529039 TACCTGTGATCCCAGCACCGTGG 0: 1
1: 9
2: 307
3: 11430
4: 195187
1142155020_1142155034 16 Left 1142155020 16:88528995-88529017 CCCCGGCCGGGTACAGGAGCCAT 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1142155034 16:88529034-88529056 CCGTGGGAGGCCGAGGCAGGAGG 0: 8
1: 618
2: 31248
3: 130394
4: 179899
1142155020_1142155032 13 Left 1142155020 16:88528995-88529017 CCCCGGCCGGGTACAGGAGCCAT 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1142155032 16:88529031-88529053 GCACCGTGGGAGGCCGAGGCAGG 0: 18
1: 1556
2: 93399
3: 232164
4: 326496
1142155020_1142155026 0 Left 1142155020 16:88528995-88529017 CCCCGGCCGGGTACAGGAGCCAT 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1142155026 16:88529018-88529040 ACCTGTGATCCCAGCACCGTGGG 0: 2
1: 48
2: 2699
3: 87410
4: 345604
1142155020_1142155030 9 Left 1142155020 16:88528995-88529017 CCCCGGCCGGGTACAGGAGCCAT 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1142155030 16:88529027-88529049 CCCAGCACCGTGGGAGGCCGAGG 0: 24
1: 2119
2: 124816
3: 274645
4: 321426
1142155020_1142155028 3 Left 1142155020 16:88528995-88529017 CCCCGGCCGGGTACAGGAGCCAT 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1142155028 16:88529021-88529043 TGTGATCCCAGCACCGTGGGAGG 0: 6
1: 172
2: 9318
3: 317610
4: 331903

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142155020 Original CRISPR ATGGCTCCTGTACCCGGCCG GGG (reversed) Intronic
900431772 1:2606101-2606123 CTGGCTCCTGTCCACGTCCGTGG - Intronic
901135310 1:6989147-6989169 ATGGCTCCTGCATCAGGCTGTGG - Intronic
901664783 1:10819983-10820005 CTGGCTCCTGTCCCCGGTTGGGG - Intergenic
901853999 1:12032405-12032427 ATGGCTCCTCCACCCAGCCATGG + Intergenic
905643986 1:39611781-39611803 GTGGATCCTGTGCCTGGCCGTGG + Intergenic
909346236 1:74590720-74590742 ATGGACCCTGTACCAGTCCGTGG + Intronic
910858404 1:91719348-91719370 ATGGCTGCGGTACTCGGCCCCGG - Exonic
915334611 1:155133850-155133872 GTGGCTCCTTTACCAGGCTGAGG + Intronic
916168539 1:161984019-161984041 ATGGCTCATCTACCCGGCCCTGG - Exonic
917845897 1:179019938-179019960 ATGGCTGCTGTACCCCTCTGGGG - Intergenic
919726984 1:200891068-200891090 ATGGCCCCTCTCCCCGGCCCTGG - Intronic
1070898322 10:80005192-80005214 TGGGCTACTGTACCCGGCCTTGG - Intergenic
1072628557 10:97130055-97130077 TTGGCTCCTGTTCCTGGCGGCGG - Intronic
1081915543 11:46728083-46728105 CTGCCTCCTGTACCCGCCCTGGG + Exonic
1091206437 11:133824464-133824486 CTGGCTCCTGTGCCCGGGGGGGG - Intergenic
1092035692 12:5332765-5332787 CTGGCTCCTGTACACTGCAGAGG + Intergenic
1094204894 12:27829725-27829747 AGGGCTCCTGTACCTGGAAGGGG + Intergenic
1103446831 12:121000249-121000271 AAGGTTCCTGGACCCGGCCCTGG + Intronic
1106694356 13:32155560-32155582 ACGGCTCCTGTAACCGGCATGGG - Exonic
1109857778 13:68156094-68156116 ATGGGTGCTGTACCCTGCAGAGG - Intergenic
1118839640 14:69500851-69500873 ATGGCTCCTCTTCCTGGCAGGGG + Exonic
1118896985 14:69953516-69953538 ATGGCTCCTTTACCCAGGTGAGG + Exonic
1123809350 15:23907649-23907671 ATGGCTCCTGCACACAGCCCTGG - Intergenic
1127623054 15:60752767-60752789 ATGGCCCCTGCACCAGGCCTGGG - Intronic
1127734830 15:61830836-61830858 ATGCCTCCTGTTCCAGGCCCTGG - Intergenic
1132630075 16:913037-913059 ACGGCTCCTCTCCCCGGCAGTGG - Intronic
1136450450 16:30351725-30351747 GTGGCTCCTGGACCCCACCGTGG - Exonic
1141839730 16:86567043-86567065 CTGGCTCCAGGACCCGGCGGCGG - Intergenic
1142155020 16:88528995-88529017 ATGGCTCCTGTACCCGGCCGGGG - Intronic
1144488020 17:15683886-15683908 AAGGCTCCTGTACCAGGGCCAGG - Intronic
1144786763 17:17836495-17836517 AGGGCTCCTGGGCCGGGCCGGGG - Intronic
1144912996 17:18698402-18698424 AAGGCTCCTGTACCAGGGCCAGG + Exonic
1152601696 17:81265607-81265629 ATGGTGCCTGTACCCAGCCCAGG - Intronic
1153224787 18:2891276-2891298 AAGGCTCCTGTAGCCGGGCTCGG - Exonic
1161016362 19:1985673-1985695 AGTGCTCCTGGACCCGGTCGGGG + Exonic
1161057130 19:2196219-2196241 AGGGCTCCTGACCCCGGTCGGGG - Intronic
1163564995 19:18045833-18045855 CTGGCTCCTGTACACAGCCGGGG - Intergenic
937283573 2:120736388-120736410 TAGGCGCCGGTACCCGGCCGAGG - Intronic
948607633 2:239146345-239146367 GTGGCTCCTGTCCCAGGCCCGGG - Intronic
1170884790 20:20330681-20330703 ATGGCTCCTGGACCAGACCATGG + Intronic
1182254715 22:29030310-29030332 ATGGCGCCGCGACCCGGCCGCGG + Intronic
1184370177 22:44077013-44077035 ATGGGTCCTGTGCCTGCCCGGGG + Intronic
1184377034 22:44120116-44120138 ATAGCTCTTGAGCCCGGCCGCGG + Intronic
1184973999 22:48047913-48047935 CTGGCTCCTGTGCCTGGCCCTGG + Intergenic
949109911 3:247229-247251 TTGGCTCCTGTACCCTGAGGAGG + Intronic
950136992 3:10588487-10588509 ATGGCCTCAGTGCCCGGCCGTGG - Intronic
950681456 3:14588107-14588129 ATGGCTCCTGCACCCAACCTGGG + Intergenic
957504096 3:81097224-81097246 ATGGCTCCTGTACACGTCTATGG - Intergenic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
969540902 4:7788136-7788158 GTGGCTTCGGAACCCGGCCGAGG - Intronic
997580399 5:135013195-135013217 ATGGCTCCAGTTCAGGGCCGGGG + Intergenic
999250778 5:150181056-150181078 ATGGCTCCTGTCCCAGACAGAGG + Intronic
1002648467 5:180674033-180674055 CTGGCTCCTGTTCCCGGGCGCGG + Intergenic
1007508935 6:42360690-42360712 CTGGCTCCTGCACCAGGCTGTGG - Intronic
1007719563 6:43877096-43877118 GTGGCTCCTGTGCCCAGCTGTGG + Intergenic
1029494902 7:100891280-100891302 ATGGCCCCCGTACACGGCGGGGG - Exonic
1034401456 7:150864230-150864252 AGGGCTCCTGTACCGAGGCGGGG + Intergenic
1039957405 8:42218005-42218027 ATGGTTCCTGTGCCCGGCCAGGG - Intergenic
1061878301 9:133555900-133555922 GTGAGTCCTGTTCCCGGCCGAGG - Exonic
1200128811 X:153830376-153830398 ATGGCCCCTGGCCCCGGCCCGGG - Exonic
1200285552 X:154819180-154819202 ATGGCTCCTGTACTCGCAAGTGG - Intronic