ID: 1142157320

View in Genome Browser
Species Human (GRCh38)
Location 16:88538496-88538518
Sequence CGTCGGGACAGGCCGCCAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142157320_1142157333 14 Left 1142157320 16:88538496-88538518 CCCGTTGGCGGCCTGTCCCGACG No data
Right 1142157333 16:88538533-88538555 TGCTAAGCCCACCACCCGCTGGG No data
1142157320_1142157332 13 Left 1142157320 16:88538496-88538518 CCCGTTGGCGGCCTGTCCCGACG No data
Right 1142157332 16:88538532-88538554 CTGCTAAGCCCACCACCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142157320 Original CRISPR CGTCGGGACAGGCCGCCAAC GGG (reversed) Intergenic
No off target data available for this crispr