ID: 1142157321

View in Genome Browser
Species Human (GRCh38)
Location 16:88538497-88538519
Sequence CCGTCGGGACAGGCCGCCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142157321_1142157333 13 Left 1142157321 16:88538497-88538519 CCGTTGGCGGCCTGTCCCGACGG No data
Right 1142157333 16:88538533-88538555 TGCTAAGCCCACCACCCGCTGGG No data
1142157321_1142157339 30 Left 1142157321 16:88538497-88538519 CCGTTGGCGGCCTGTCCCGACGG No data
Right 1142157339 16:88538550-88538572 GCTGGGCTCCATGCTGCAGCTGG No data
1142157321_1142157332 12 Left 1142157321 16:88538497-88538519 CCGTTGGCGGCCTGTCCCGACGG No data
Right 1142157332 16:88538532-88538554 CTGCTAAGCCCACCACCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142157321 Original CRISPR CCGTCGGGACAGGCCGCCAA CGG (reversed) Intergenic