ID: 1142157457

View in Genome Browser
Species Human (GRCh38)
Location 16:88539159-88539181
Sequence GAGGAGAGAAGGAGTTTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142157457_1142157463 6 Left 1142157457 16:88539159-88539181 CCTGTGAAACTCCTTCTCTCCTC No data
Right 1142157463 16:88539188-88539210 GGCTTAAAAGGTCCCCCTCAGGG No data
1142157457_1142157460 -6 Left 1142157457 16:88539159-88539181 CCTGTGAAACTCCTTCTCTCCTC No data
Right 1142157460 16:88539176-88539198 CTCCTCAAGACTGGCTTAAAAGG No data
1142157457_1142157462 5 Left 1142157457 16:88539159-88539181 CCTGTGAAACTCCTTCTCTCCTC No data
Right 1142157462 16:88539187-88539209 TGGCTTAAAAGGTCCCCCTCAGG No data
1142157457_1142157466 19 Left 1142157457 16:88539159-88539181 CCTGTGAAACTCCTTCTCTCCTC No data
Right 1142157466 16:88539201-88539223 CCCCTCAGGGCCACCCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142157457 Original CRISPR GAGGAGAGAAGGAGTTTCAC AGG (reversed) Intergenic
No off target data available for this crispr