ID: 1142158009

View in Genome Browser
Species Human (GRCh38)
Location 16:88541519-88541541
Sequence TAATTGAAGAGGGGTTTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142158009_1142158019 28 Left 1142158009 16:88541519-88541541 CCACTTAAACCCCTCTTCAATTA No data
Right 1142158019 16:88541570-88541592 AATTGAGGAGCAGGTTACTTAGG No data
1142158009_1142158013 -8 Left 1142158009 16:88541519-88541541 CCACTTAAACCCCTCTTCAATTA No data
Right 1142158013 16:88541534-88541556 TTCAATTACATGCAAATTAAAGG 0: 26
1: 104
2: 228
3: 321
4: 602
1142158009_1142158014 -7 Left 1142158009 16:88541519-88541541 CCACTTAAACCCCTCTTCAATTA No data
Right 1142158014 16:88541535-88541557 TCAATTACATGCAAATTAAAGGG No data
1142158009_1142158017 13 Left 1142158009 16:88541519-88541541 CCACTTAAACCCCTCTTCAATTA No data
Right 1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG No data
1142158009_1142158016 -3 Left 1142158009 16:88541519-88541541 CCACTTAAACCCCTCTTCAATTA No data
Right 1142158016 16:88541539-88541561 TTACATGCAAATTAAAGGGTGGG No data
1142158009_1142158018 19 Left 1142158009 16:88541519-88541541 CCACTTAAACCCCTCTTCAATTA No data
Right 1142158018 16:88541561-88541583 GTTAATGCAAATTGAGGAGCAGG No data
1142158009_1142158015 -4 Left 1142158009 16:88541519-88541541 CCACTTAAACCCCTCTTCAATTA No data
Right 1142158015 16:88541538-88541560 ATTACATGCAAATTAAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142158009 Original CRISPR TAATTGAAGAGGGGTTTAAG TGG (reversed) Intergenic
No off target data available for this crispr