ID: 1142158011

View in Genome Browser
Species Human (GRCh38)
Location 16:88541529-88541551
Sequence AATTTGCATGTAATTGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142158011_1142158017 3 Left 1142158011 16:88541529-88541551 CCCTCTTCAATTACATGCAAATT No data
Right 1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG No data
1142158011_1142158018 9 Left 1142158011 16:88541529-88541551 CCCTCTTCAATTACATGCAAATT No data
Right 1142158018 16:88541561-88541583 GTTAATGCAAATTGAGGAGCAGG No data
1142158011_1142158019 18 Left 1142158011 16:88541529-88541551 CCCTCTTCAATTACATGCAAATT No data
Right 1142158019 16:88541570-88541592 AATTGAGGAGCAGGTTACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142158011 Original CRISPR AATTTGCATGTAATTGAAGA GGG (reversed) Intergenic
No off target data available for this crispr