ID: 1142158017

View in Genome Browser
Species Human (GRCh38)
Location 16:88541555-88541577
Sequence GGGTGGGTTAATGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142158010_1142158017 4 Left 1142158010 16:88541528-88541550 CCCCTCTTCAATTACATGCAAAT No data
Right 1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG No data
1142158012_1142158017 2 Left 1142158012 16:88541530-88541552 CCTCTTCAATTACATGCAAATTA No data
Right 1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG No data
1142158011_1142158017 3 Left 1142158011 16:88541529-88541551 CCCTCTTCAATTACATGCAAATT No data
Right 1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG No data
1142158009_1142158017 13 Left 1142158009 16:88541519-88541541 CCACTTAAACCCCTCTTCAATTA No data
Right 1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142158017 Original CRISPR GGGTGGGTTAATGCAAATTG AGG Intergenic
No off target data available for this crispr