ID: 1142158524

View in Genome Browser
Species Human (GRCh38)
Location 16:88545081-88545103
Sequence CAATGTCTGCAGTGGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142158520_1142158524 1 Left 1142158520 16:88545057-88545079 CCAACACGGGGGCAGTTTTTGAT No data
Right 1142158524 16:88545081-88545103 CAATGTCTGCAGTGGCTGGAGGG No data
1142158518_1142158524 11 Left 1142158518 16:88545047-88545069 CCGCACCTGGCCAACACGGGGGC No data
Right 1142158524 16:88545081-88545103 CAATGTCTGCAGTGGCTGGAGGG No data
1142158519_1142158524 6 Left 1142158519 16:88545052-88545074 CCTGGCCAACACGGGGGCAGTTT No data
Right 1142158524 16:88545081-88545103 CAATGTCTGCAGTGGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142158524 Original CRISPR CAATGTCTGCAGTGGCTGGA GGG Intergenic
No off target data available for this crispr