ID: 1142159268

View in Genome Browser
Species Human (GRCh38)
Location 16:88548248-88548270
Sequence CCTTCCCCCGGGAGGGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142159268_1142159278 4 Left 1142159268 16:88548248-88548270 CCTGTCACCCTCCCGGGGGAAGG No data
Right 1142159278 16:88548275-88548297 TCCAGGCCCACAGCCCTGGCAGG No data
1142159268_1142159277 0 Left 1142159268 16:88548248-88548270 CCTGTCACCCTCCCGGGGGAAGG No data
Right 1142159277 16:88548271-88548293 GGCTTCCAGGCCCACAGCCCTGG No data
1142159268_1142159284 15 Left 1142159268 16:88548248-88548270 CCTGTCACCCTCCCGGGGGAAGG No data
Right 1142159284 16:88548286-88548308 AGCCCTGGCAGGTTCATGTGGGG No data
1142159268_1142159283 14 Left 1142159268 16:88548248-88548270 CCTGTCACCCTCCCGGGGGAAGG No data
Right 1142159283 16:88548285-88548307 CAGCCCTGGCAGGTTCATGTGGG No data
1142159268_1142159287 21 Left 1142159268 16:88548248-88548270 CCTGTCACCCTCCCGGGGGAAGG No data
Right 1142159287 16:88548292-88548314 GGCAGGTTCATGTGGGGCACTGG No data
1142159268_1142159282 13 Left 1142159268 16:88548248-88548270 CCTGTCACCCTCCCGGGGGAAGG No data
Right 1142159282 16:88548284-88548306 ACAGCCCTGGCAGGTTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142159268 Original CRISPR CCTTCCCCCGGGAGGGTGAC AGG (reversed) Intergenic
No off target data available for this crispr