ID: 1142160252

View in Genome Browser
Species Human (GRCh38)
Location 16:88553868-88553890
Sequence GAGGAAGGAGTCAGCCCCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142160245_1142160252 2 Left 1142160245 16:88553843-88553865 CCACTGCTGTTTTGTGGGATCTG No data
Right 1142160252 16:88553868-88553890 GAGGAAGGAGTCAGCCCCGGTGG No data
1142160242_1142160252 14 Left 1142160242 16:88553831-88553853 CCGAGTGGAGATCCACTGCTGTT No data
Right 1142160252 16:88553868-88553890 GAGGAAGGAGTCAGCCCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142160252 Original CRISPR GAGGAAGGAGTCAGCCCCGG TGG Intergenic
No off target data available for this crispr