ID: 1142160393

View in Genome Browser
Species Human (GRCh38)
Location 16:88554574-88554596
Sequence ACGAGGACCTTTGTGGTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142160382_1142160393 25 Left 1142160382 16:88554526-88554548 CCAGCAGGGCAGCCTCTCCTCTC No data
Right 1142160393 16:88554574-88554596 ACGAGGACCTTTGTGGTTCAGGG No data
1142160386_1142160393 -6 Left 1142160386 16:88554557-88554579 CCTGCTGCCCGCCTCTTACGAGG No data
Right 1142160393 16:88554574-88554596 ACGAGGACCTTTGTGGTTCAGGG No data
1142160385_1142160393 3 Left 1142160385 16:88554548-88554570 CCTCTCTGACCTGCTGCCCGCCT No data
Right 1142160393 16:88554574-88554596 ACGAGGACCTTTGTGGTTCAGGG No data
1142160384_1142160393 8 Left 1142160384 16:88554543-88554565 CCTCTCCTCTCTGACCTGCTGCC No data
Right 1142160393 16:88554574-88554596 ACGAGGACCTTTGTGGTTCAGGG No data
1142160383_1142160393 13 Left 1142160383 16:88554538-88554560 CCTCTCCTCTCCTCTCTGACCTG No data
Right 1142160393 16:88554574-88554596 ACGAGGACCTTTGTGGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142160393 Original CRISPR ACGAGGACCTTTGTGGTTCA GGG Intergenic
No off target data available for this crispr