ID: 1142166888

View in Genome Browser
Species Human (GRCh38)
Location 16:88595970-88595992
Sequence ACACACTTCCAGCAGACGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142166888 Original CRISPR ACACACTTCCAGCAGACGTC AGG (reversed) Intronic
910245653 1:85135508-85135530 ACACACTTCTAGAAGACTACAGG - Intergenic
916498940 1:165369903-165369925 CCACTCTTCCAGCTGACCTCAGG + Intergenic
924577826 1:245296479-245296501 ACCCACTTCCAGCAGCTGCCCGG - Intronic
1063137328 10:3229095-3229117 AGATACTTCCAGCAGAGGCCAGG - Intergenic
1069788883 10:71006727-71006749 ACAGACTTCCAGCTGCCGTCTGG - Intergenic
1072727811 10:97825409-97825431 CCACACTTCCAGCAGACAGTGGG - Intergenic
1075050436 10:119179219-119179241 ACACAATTCCAGCGGATTTCAGG - Intergenic
1075075159 10:119345715-119345737 CCACCCTGCCAGCAGACTTCAGG + Intronic
1075717854 10:124567173-124567195 ACACAATCACAGCAGAGGTCTGG - Intronic
1077869824 11:6252291-6252313 ACACACGTGCAGCTGAGGTCTGG - Intergenic
1086377694 11:86217886-86217908 ACATCCTGCCAGCAGAAGTCTGG - Intergenic
1090218537 11:124994252-124994274 AGATACTTCCAGCAGACGACAGG + Intronic
1091301124 11:134508853-134508875 ACACACTTCCCGCACCCGTGCGG - Intergenic
1091537397 12:1424752-1424774 ACACACTTTCAGCAGACGGCTGG - Intronic
1098150342 12:67539984-67540006 AGACACTTCCCGCAGAAGGCAGG + Intergenic
1105701556 13:22938915-22938937 CCACACTCCCAGCAGCCGGCTGG - Intergenic
1109248643 13:59989895-59989917 TCAAACTTCCAGAAGACGACAGG + Intronic
1117695249 14:58355308-58355330 ACACATTTCCAGCAGATGAGAGG - Intronic
1117857511 14:60051067-60051089 ACACACTTACAGGAGTAGTCTGG + Intronic
1122184657 14:99981995-99982017 AAGCACTTCCAGCTGATGTCGGG + Intronic
1124896417 15:33781406-33781428 ATACACTACCAGTAGATGTCTGG + Intronic
1127337439 15:58003007-58003029 AGAAACTACCAGCAGACTTCTGG - Intronic
1132884314 16:2175861-2175883 ATCCACGTCCTGCAGACGTCTGG + Exonic
1136272799 16:29158497-29158519 ACACACATGCAGCAGAAGGCGGG - Intergenic
1140685767 16:77433209-77433231 ACAGACTTCCTGCATATGTCAGG - Intronic
1140999589 16:80295974-80295996 ACACTCATCCAGCAGATGCCAGG - Intergenic
1141700023 16:85638110-85638132 AGGCACTTCCAGAAGTCGTCAGG - Intronic
1142076356 16:88120309-88120331 ACACACATGCAGCAGAAGGCAGG - Intergenic
1142166888 16:88595970-88595992 ACACACTTCCAGCAGACGTCAGG - Intronic
1154069438 18:11140183-11140205 ACACACTTTCACCAGAAGTATGG - Intronic
1156445365 18:37232782-37232804 CCAGACTTCCAGCAGAGGACAGG + Intergenic
1156478224 18:37419908-37419930 ACACCCTTCCCGCCGACCTCGGG - Intronic
1158309461 18:56143104-56143126 GCACACTTCCAACACACTTCAGG - Intergenic
1160893789 19:1393415-1393437 CCACACCCCCAGCAGACGGCGGG + Intronic
1162148717 19:8630075-8630097 ACAAACTTCCAGATGAGGTCTGG + Intergenic
1164372818 19:27656682-27656704 AGAGATTTCCAGCAGACTTCAGG - Intergenic
927163284 2:20291133-20291155 ACTCAGTTCCAGCAGATGTCAGG - Intronic
927719042 2:25371623-25371645 ACTCACTTCCAGCAGGGGTCTGG - Intergenic
937044787 2:118845476-118845498 CCGCACATCCAGCAGACTTCTGG - Intronic
938061069 2:128254655-128254677 ACACCATCCCAGCAGACGTTGGG - Intronic
940400705 2:153244888-153244910 TCTCACTGCCAGCAGAAGTCTGG + Intergenic
1170787383 20:19479387-19479409 AAACACTTCAAGGAGATGTCAGG - Intronic
1175740134 20:61414303-61414325 ACCCACTTCCTGCAGGCATCAGG - Intronic
1179508966 21:41859681-41859703 ACACCCTGCAAGCAGACATCCGG + Exonic
955167544 3:56529154-56529176 ACATACTTCCAGCAGACCCTGGG - Intergenic
960776335 3:121259931-121259953 ACATAATTCAAGCAGACATCAGG + Intronic
967047034 3:185746956-185746978 TCACACTTCCAGAAGAAGGCAGG - Intronic
969459042 4:7317959-7317981 AGAAACTTCCAGCAAACGTCTGG + Intronic
970017789 4:11532043-11532065 CCCCACTTCTAGCATACGTCTGG + Intergenic
984788253 4:183589679-183589701 TCACACTTCCAACAGACTCCTGG + Intergenic
987865179 5:23527663-23527685 CCACACTCCCTGCAGACGTAGGG - Exonic
996486102 5:124036568-124036590 ACTCACTCCCAGCAGACATAAGG - Intergenic
1007089376 6:39172653-39172675 CCACACTCCCAGGAGACGTTTGG - Intergenic
1007238285 6:40406603-40406625 ACACACTTCCAGGACATGCCAGG + Intronic
1010393951 6:75369216-75369238 AAACACTTCCAGCAGTCTTCAGG - Intronic
1010761979 6:79733989-79734011 ACTCACTTCCAGGAGAAATCTGG + Intergenic
1014286498 6:119504590-119504612 AAACACTACCAGCAAACTTCAGG - Intergenic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1023613282 7:41993111-41993133 TCACACATCCAGCTGACTTCTGG - Intronic
1027587026 7:80070541-80070563 ACTCTCTTCCAGCAGACTACTGG - Intergenic
1028978407 7:96939608-96939630 ACACAAATCCAGTAGAAGTCAGG + Intergenic
1029180822 7:98700529-98700551 CCACAGTTCCAGCAGAGGCCAGG + Intergenic
1029345493 7:99975774-99975796 ACACACTTCCAGGAGCATTCAGG - Intronic
1029346290 7:99980997-99981019 ACACACTTCCAGGAGCATTCAGG + Intergenic
1029429420 7:100520545-100520567 ACACAGTTCCATCATAAGTCAGG + Intergenic
1029558882 7:101289518-101289540 ACACACTTCCAGGAGCATTCAGG - Intergenic
1031482835 7:122299863-122299885 TGACACTTCCTGCAGACATCGGG - Intergenic
1040572097 8:48620267-48620289 ACACACGGCCAGCAGTCTTCAGG + Intergenic
1040660224 8:49564854-49564876 ACACACTTGCATAAGACTTCTGG - Intergenic
1041173047 8:55164810-55164832 ACACACGTTCAGCAGAGCTCAGG + Intronic
1041245326 8:55883610-55883632 AGACACTCCCAGCACAGGTCGGG - Intronic
1042818675 8:72906359-72906381 AAACACTTCCAGAAGAGGTTTGG + Intronic
1047458546 8:125039372-125039394 ACACACTTCCAACTGCCCTCTGG + Intronic
1053079480 9:35162357-35162379 GCACCCTTCCAGTGGACGTCCGG + Intronic
1187548095 X:20272673-20272695 AGACACTTCCAGTTGAGGTCTGG - Intergenic
1190230542 X:48578668-48578690 ACCCAATTCCAGCAGGCCTCAGG - Exonic
1197964478 X:132043594-132043616 ACACAATTCAACCAGGCGTCAGG - Intergenic
1199221108 X:145316455-145316477 ACAAACCTCCAGCAGGCATCAGG + Intergenic
1201798807 Y:17930636-17930658 AAACAATTTAAGCAGACGTCTGG + Intergenic
1201802746 Y:17975321-17975343 AAACAATTTAAGCAGACGTCTGG - Intergenic
1202360108 Y:24099252-24099274 AAACAATTTAAGCAGACGTCTGG + Intergenic
1202510669 Y:25570862-25570884 AAACAATTTAAGCAGACGTCTGG - Intergenic