ID: 1142167797

View in Genome Browser
Species Human (GRCh38)
Location 16:88602142-88602164
Sequence TGCCTGCAGCGGGCACAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 243}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142167797_1142167803 -10 Left 1142167797 16:88602142-88602164 CCTACCTGTGCCCGCTGCAGGCA 0: 1
1: 0
2: 2
3: 21
4: 243
Right 1142167803 16:88602155-88602177 GCTGCAGGCAGGGCCTCACCTGG 0: 1
1: 0
2: 5
3: 46
4: 554
1142167797_1142167809 23 Left 1142167797 16:88602142-88602164 CCTACCTGTGCCCGCTGCAGGCA 0: 1
1: 0
2: 2
3: 21
4: 243
Right 1142167809 16:88602188-88602210 AAAGCAGGTCGCAGCTTGTAGGG No data
1142167797_1142167808 22 Left 1142167797 16:88602142-88602164 CCTACCTGTGCCCGCTGCAGGCA 0: 1
1: 0
2: 2
3: 21
4: 243
Right 1142167808 16:88602187-88602209 CAAAGCAGGTCGCAGCTTGTAGG 0: 1
1: 0
2: 0
3: 3
4: 88
1142167797_1142167804 -1 Left 1142167797 16:88602142-88602164 CCTACCTGTGCCCGCTGCAGGCA 0: 1
1: 0
2: 2
3: 21
4: 243
Right 1142167804 16:88602164-88602186 AGGGCCTCACCTGGAACAGCTGG 0: 1
1: 1
2: 3
3: 25
4: 282
1142167797_1142167807 8 Left 1142167797 16:88602142-88602164 CCTACCTGTGCCCGCTGCAGGCA 0: 1
1: 0
2: 2
3: 21
4: 243
Right 1142167807 16:88602173-88602195 CCTGGAACAGCTGGCAAAGCAGG 0: 1
1: 0
2: 2
3: 30
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142167797 Original CRISPR TGCCTGCAGCGGGCACAGGT AGG (reversed) Intronic
900228509 1:1544060-1544082 GGCCTGCAGCCGGCAGAGCTGGG - Intronic
900289205 1:1916732-1916754 TGTCTGCAAGGGGCACAGCTGGG - Exonic
900393423 1:2443565-2443587 TGGCTGCGGCGGGCGCAGGGCGG + Intronic
900425871 1:2578371-2578393 TTCCTGCAGTGGGCACGGGCAGG - Intergenic
900475960 1:2876518-2876540 TGGCAGCAGCTGGCACAGGGTGG - Intergenic
900488764 1:2935932-2935954 TTCCTGGAGTGGGCACAGGGAGG + Intergenic
900595166 1:3477142-3477164 AGTCTGTAGTGGGCACAGGTGGG + Intronic
902396554 1:16135091-16135113 TGCCTGCACCTGGACCAGGTAGG + Exonic
903233111 1:21933792-21933814 TACCTGCAGCCGGCACAGGATGG - Intronic
903516105 1:23912067-23912089 TGTCTGATGCGGGCACAGGGCGG - Intronic
905726653 1:40258116-40258138 TGCCAGCAGCGCGCAGAGGGAGG + Exonic
905726862 1:40259459-40259481 TGCCAGCAGCGCGCAGAGGGAGG + Intronic
905775020 1:40662858-40662880 TGCCTGAAGTGGTAACAGGTTGG + Intronic
907372520 1:54012424-54012446 AGCCGGCAGCGGGTACAGCTGGG - Intronic
908942738 1:69455156-69455178 TGCCTGCAGCTCTCTCAGGTTGG - Intergenic
909027130 1:70494977-70494999 TTCCTGCAGGGGTCACAGCTGGG - Intergenic
914977749 1:152381147-152381169 TGCCTGCTGTGGGCACACCTAGG + Intergenic
915354966 1:155250510-155250532 TGCCCGCAGCTGCCACCGGTTGG - Exonic
916578362 1:166086800-166086822 TGTCTGCAGTTGGCAGAGGTGGG + Intronic
919130322 1:193442484-193442506 TGCCTGCAGCTTTCACAGGCTGG - Intergenic
919859210 1:201727982-201728004 TGACTGCAGGGGGCATAGGTGGG + Intronic
921055865 1:211542093-211542115 TGCGTGCAGAGGTCACAGCTGGG - Intergenic
923351554 1:233112259-233112281 TGCCTACAGCCAGCACAGGAAGG + Intronic
923484114 1:234412856-234412878 GGCCTGCATCGGGCATATGTAGG - Intronic
924743873 1:246814836-246814858 TGCCTGCAGCAGGGACAGTGTGG + Intergenic
1063065792 10:2607005-2607027 TGCCTGCAGAGTGAAAAGGTTGG + Intergenic
1067061453 10:43079972-43079994 TGCCTGCAGCCCTCACTGGTGGG + Intronic
1068134852 10:52941217-52941239 TGCCTGCTGCGGACACACCTAGG - Intergenic
1068648205 10:59492890-59492912 TCCCTGCAGCTGGGGCAGGTGGG - Intergenic
1069557814 10:69408931-69408953 GGCCTGCAGGTGGCGCAGGTTGG + Exonic
1069609500 10:69763339-69763361 TGCCTGCAGTGGTCACCTGTTGG - Intergenic
1069980345 10:72248091-72248113 TGCCAGCTGCAGGCAAAGGTGGG - Intergenic
1070844451 10:79510524-79510546 TGCCTGCAAGCAGCACAGGTAGG - Intergenic
1072190158 10:93071908-93071930 GGCCTGCAGGGGTCACAGGCGGG + Intergenic
1072190197 10:93072064-93072086 TTCCTGCAGTGGCCAGAGGTTGG + Intergenic
1072958606 10:99908948-99908970 CCCATGCAGCAGGCACAGGTGGG - Exonic
1073044999 10:100631901-100631923 GGCCCGCAGCGGGCACGGGCGGG - Intergenic
1073321743 10:102619961-102619983 TGCCTGCAGGGAGCAAGGGTGGG - Intronic
1073449030 10:103598683-103598705 TGCCGGCAGCAGGCAGAGGAGGG - Exonic
1075114010 10:119610871-119610893 TGCCTGCAATGGGGACAGGAAGG + Intergenic
1075438555 10:122462032-122462054 GGCGCGCAGCTGGCACAGGTTGG - Exonic
1076659423 10:132045423-132045445 TACCCGCACCTGGCACAGGTGGG + Intergenic
1076714335 10:132355674-132355696 TGTCTCCAGGGGGCACAGGCTGG - Intronic
1076807431 10:132866097-132866119 TGCCTTCAGCATCCACAGGTGGG + Exonic
1077308033 11:1876569-1876591 TGCCTGCAGGGGGCAGAGTCGGG + Intronic
1081657329 11:44866109-44866131 TGGCAGCAGAGGGCACAGCTGGG - Intronic
1082792955 11:57359776-57359798 TGCCTGCAAGGGGCACAGCTGGG - Intronic
1083397077 11:62399611-62399633 TGCCTGCAGCGGGCTCAGATGGG + Intergenic
1083409182 11:62480122-62480144 TCCCAGCAGTGGGCACAGGCAGG - Intronic
1083759451 11:64807718-64807740 TCCCTGAAGCAGGCACAGGGTGG - Intronic
1084166030 11:67375096-67375118 TGCCTGCCCAGGCCACAGGTTGG - Intronic
1084304427 11:68272214-68272236 AGACGGCAGCGGGCACAGCTGGG - Intergenic
1084713838 11:70861067-70861089 TGCCTGCAGAGGGGGCAGGTCGG - Intronic
1084954466 11:72684087-72684109 TGCCTCCAGCCAGGACAGGTTGG - Intergenic
1084957269 11:72698003-72698025 AGCCTACAGCGGGCCCAGGAGGG - Exonic
1085200279 11:74697716-74697738 TCCCTGCACTGGGGACAGGTGGG - Intronic
1085394451 11:76200248-76200270 TGCCAGCATCCGGCACAGGGTGG + Intronic
1085689043 11:78650900-78650922 TGCCTGACGCGGGCAGGGGTGGG + Intergenic
1086131854 11:83409473-83409495 TGCCTGGAGTGGGCACAGAAGGG - Intergenic
1087096970 11:94328528-94328550 TGCTTGCAGCTGTCCCAGGTTGG + Intergenic
1087461836 11:98456009-98456031 TGCCTGCGGTGGGCACACCTAGG + Intergenic
1089920223 11:122202759-122202781 TGGCTGCAGAGCACACAGGTAGG - Intergenic
1090453176 11:126824319-126824341 TGAATGCACCTGGCACAGGTAGG - Intronic
1090540658 11:127699925-127699947 TCCTTGCAGTGGACACAGGTAGG + Intergenic
1090805105 11:130197824-130197846 GGCATGCTGCGGGCACAGGCAGG - Exonic
1092241173 12:6837414-6837436 TGCCTGCAGCTGGCCCGGGCTGG + Exonic
1092286411 12:7131338-7131360 TGCGGGCAGAGGGCTCAGGTAGG + Intronic
1092415072 12:8284592-8284614 TGGTTGCAGCGGGCTCAGATGGG + Intergenic
1093906078 12:24693238-24693260 TGCCTCCAGTGGGCTCAGCTGGG + Intergenic
1096858549 12:54505208-54505230 TGCCTGCACAGGGCACATTTTGG + Intronic
1098147996 12:67517257-67517279 AGAGTGCAGCTGGCACAGGTAGG + Intergenic
1103703810 12:122860938-122860960 TTCCTGCAGGCGGCTCAGGTGGG - Exonic
1104547097 12:129722363-129722385 GGCTTGCAGCAGGCCCAGGTTGG - Intronic
1105418968 13:20236142-20236164 TGCCTGCAGCTTTCCCAGGTTGG + Intergenic
1106180197 13:27363198-27363220 TGCCTGCAGCGAGGACATCTAGG - Intergenic
1106284952 13:28310333-28310355 TGACTGCATCGGGTACAGGGAGG + Intronic
1107383506 13:39882443-39882465 TTCCTGCAGTGTGCACAGATTGG - Intergenic
1108204872 13:48078318-48078340 TGTCAGTAGAGGGCACAGGTGGG + Intronic
1113358973 13:109610706-109610728 AGCCAGCAGAGGGCAGAGGTGGG + Intergenic
1116396754 14:44455742-44455764 TGCCTGACGGGGGCACATGTGGG - Intergenic
1118836693 14:69483341-69483363 TGCCTGCAGAGGGGCCAGGCAGG + Intergenic
1120751809 14:88204587-88204609 TGCCTGCAGCGGGGGTAGGGGGG - Intronic
1121581083 14:95031381-95031403 TGCCTGGAGCTGGTAGAGGTGGG - Intergenic
1122766819 14:104078115-104078137 TGCCGGCAGAGGGCACTGGAGGG + Intergenic
1122783699 14:104154417-104154439 GGCCTCCTGCGGCCACAGGTGGG + Intronic
1122885535 14:104708802-104708824 GGCCTGCAGAGGGCACTGCTGGG - Intronic
1122887011 14:104714650-104714672 CCCCTGCAGCAGGCCCAGGTGGG + Exonic
1122946370 14:105012362-105012384 AGCCTGCAGAGGGCGCAGGGCGG + Intronic
1124594854 15:31083791-31083813 TAGCTGCAGAGAGCACAGGTAGG + Intronic
1125506725 15:40271661-40271683 TCCCTGCTGCAGGCACAGGCAGG + Intronic
1130561127 15:84960078-84960100 TGCCTGGAGAGGGCACACATAGG + Intergenic
1131662457 15:94532444-94532466 TGCCAGCAGGGAGCAGAGGTCGG + Intergenic
1132556527 16:575137-575159 GGCCTGCTGGGGGCACAGGCAGG - Intronic
1133035315 16:3030930-3030952 AGCCAGCAGCTGGCTCAGGTGGG - Exonic
1133161203 16:3912914-3912936 AGACTGCAGGGGGCCCAGGTGGG + Intergenic
1133231428 16:4368862-4368884 TGGCTGCTGGGGGCACAGGCTGG + Intronic
1134094575 16:11411114-11411136 AGCCTGCAGCAGGCTCCGGTGGG - Intronic
1134442527 16:14307788-14307810 TTCCTGGAGCAGGCACATGTTGG - Intergenic
1134452025 16:14369476-14369498 TGTCTGCAGAGGACACAGGCAGG - Intergenic
1136684140 16:31984172-31984194 TGCCTGCAGGGAGCAAGGGTAGG + Intergenic
1136784767 16:32927724-32927746 TGCCCGCAGGGAGCAAAGGTAGG + Intergenic
1136885016 16:33926082-33926104 TGCCCGCAGGGAGCAAAGGTAGG - Intergenic
1139800531 16:69519060-69519082 TGAGTGCAGCAGGCACACGTCGG + Intergenic
1141798689 16:86292353-86292375 TGCCAGCAACGGGTACAGGAAGG - Intergenic
1141805839 16:86340922-86340944 CACCTGCAGAGTGCACAGGTTGG + Intergenic
1142150013 16:88508585-88508607 TGCCTGCCGTGGGCCCTGGTTGG + Intronic
1142167797 16:88602142-88602164 TGCCTGCAGCGGGCACAGGTAGG - Intronic
1142302860 16:89268791-89268813 TGCCAGGAGCGGGTACAGCTGGG - Intronic
1142697326 17:1640649-1640671 TGTTTGCAGCGGCCACAGCTGGG + Exonic
1143765955 17:9137935-9137957 TGCCTGCAGTGAGCTCAGGGCGG + Intronic
1144765905 17:17732330-17732352 GGCCTGAAGCAGGAACAGGTTGG + Intronic
1145061516 17:19737222-19737244 TGCTGGGAGCAGGCACAGGTGGG + Intergenic
1145992113 17:29085513-29085535 TGCGTGCAGCGGCCCCAGGGTGG + Intronic
1146884842 17:36464073-36464095 GGCCTGGAGCGGGCCCAGGCTGG + Intergenic
1148023070 17:44566364-44566386 TGCCTGCTGCGGGCACGCATGGG + Intergenic
1148560708 17:48604348-48604370 TCCCTGCAGCGCCCAGAGGTGGG + Intronic
1148699728 17:49580183-49580205 TCTCAGCAGCGGGCACGGGTGGG + Exonic
1150267276 17:63839665-63839687 TGCCTGCAGCAGGACCAGGTAGG + Intronic
1151576197 17:74953649-74953671 TGCCTGGGCAGGGCACAGGTGGG + Exonic
1152134291 17:78494822-78494844 TGCGGGCAGTGGGCACAGGTGGG + Intronic
1152375014 17:79914501-79914523 AGCCAGCAGCGGGCACTGGCCGG - Intergenic
1152579963 17:81161517-81161539 TGCCTCCAGGGGGCACAGGCAGG + Intronic
1152639400 17:81443390-81443412 TCCCTGCTGCGGGCACAGTCCGG - Exonic
1152822255 17:82443407-82443429 TGGCTGCAGCGTGCACAGCCAGG + Exonic
1153297799 18:3564337-3564359 TGCCTGAAGGGGGCTGAGGTTGG + Intronic
1157755651 18:50214980-50215002 TGGCTCCAGATGGCACAGGTAGG - Intergenic
1158836292 18:61334232-61334254 CGCCTGCAGAGGGGACAGGGTGG + Intronic
1158938951 18:62389352-62389374 TGCCAGCAGTGAGCACAGGCGGG + Exonic
1160584250 18:79903927-79903949 CGCCAGCCGCGGGCACTGGTGGG - Exonic
1161139113 19:2637471-2637493 TGGCTCCTGCGGGCACAGGGTGG - Intronic
1161585475 19:5103146-5103168 TGCCTGCAGGAGGCACACATTGG - Intronic
1162030364 19:7914645-7914667 TGCCCCCAGTGGCCACAGGTCGG + Intergenic
1165791758 19:38496840-38496862 TGCCTGCAGGGGCGAGAGGTGGG - Exonic
1166288576 19:41847546-41847568 TTGCGGCAGCGGGCGCAGGTTGG - Exonic
925625730 2:5840839-5840861 TGTCTCCAGCAGGCACAGATAGG - Intergenic
926206159 2:10835485-10835507 TGCCTGCAGCGACCCCTGGTGGG - Intronic
929828836 2:45331338-45331360 TGCCAGCATCTGGCACAGCTGGG + Intergenic
930924409 2:56799277-56799299 TGTCTGCAGGGGGCATAGGATGG + Intergenic
932435433 2:71700363-71700385 CACCTGCAGGGGGGACAGGTGGG + Intergenic
932476870 2:72011827-72011849 TGCCAGCAGCTGGCACCTGTGGG + Intergenic
932615238 2:73227272-73227294 GGCGTGCAGCAGGCACAGGTGGG + Intergenic
938769855 2:134491993-134492015 TGCCAGCAGGTGGCACAGGCTGG - Intronic
942227860 2:173832333-173832355 TGCCTGCTGCGGGCATAGCCAGG - Intergenic
944128929 2:196325035-196325057 TGCCCGTGGTGGGCACAGGTGGG + Exonic
946174923 2:217916704-217916726 TGGCTGGCCCGGGCACAGGTTGG + Intronic
946442215 2:219706393-219706415 TGCCTGTAGGAGGCAGAGGTGGG - Intergenic
946630510 2:221662565-221662587 TGCTTGCAGAGGGCAATGGTAGG - Intergenic
947526026 2:230877247-230877269 TGCAGGCACCGGGCACAGGCAGG + Intronic
947908013 2:233779835-233779857 TGCCTGCAGGTGCCAGAGGTAGG + Exonic
948099853 2:235365076-235365098 TCCCTGCAGGGCGCAGAGGTGGG - Intergenic
948501626 2:238398309-238398331 GCCCTGCAGCAGGAACAGGTTGG + Intronic
948696500 2:239735626-239735648 TGCAGGCAGCCGGCACGGGTGGG + Intergenic
948815151 2:240506743-240506765 TGCCCACAGCGGACACAGGAAGG + Intronic
949025308 2:241765051-241765073 TGTCTGCAGTGGGCACTGGCTGG + Intronic
1169195944 20:3682071-3682093 AGGCTGCACCGGGCACGGGTCGG - Exonic
1172181690 20:33007694-33007716 TGCCTGCCTCGGGCAGAGGAGGG + Exonic
1174383596 20:50172844-50172866 GGCCTGCAGAGGGGACAGGCAGG + Intergenic
1174426623 20:50436188-50436210 TGCCTGCACCCGGCACTGCTGGG - Intergenic
1175220583 20:57414365-57414387 TGCCTGCAGCTGGCCCAGGCTGG - Intergenic
1175333928 20:58182826-58182848 TGCAGGCAGTGGGCACAGGCAGG - Intergenic
1175540786 20:59746352-59746374 TGCCTGATGCCAGCACAGGTGGG - Intronic
1175720804 20:61285898-61285920 TGCCTGCTGAGGCCAGAGGTTGG - Intronic
1175993113 20:62799256-62799278 TGCCTGCGGCGGGCACTGCAGGG - Intronic
1178752494 21:35318013-35318035 TGCCTCTAGCTGGCATAGGTGGG - Intronic
1179035161 21:37753140-37753162 TGCCTGCAGCGTGTGCAGCTGGG + Intronic
1179680912 21:43020771-43020793 TCGCTGCAGGAGGCACAGGTGGG + Intronic
1179813327 21:43886053-43886075 AGCCTGCAAAGGGCACAGCTGGG + Intronic
1181037002 22:20174552-20174574 TGCCTGCAGCACGCAGAGGAGGG + Intergenic
1181169596 22:21000672-21000694 TGACTTCAGCGGGGCCAGGTGGG + Exonic
1182697340 22:32206062-32206084 TGGCTGCAGCAGGGGCAGGTTGG + Intergenic
1183193516 22:36336984-36337006 TGTCTGCCGTGGGCACGGGTGGG - Intronic
1183786156 22:40030309-40030331 TGCCTGCTGCGGGCCTATGTGGG + Exonic
1184287775 22:43481710-43481732 AGCCAGCAGGGGGCACAGTTAGG - Intronic
1185179002 22:49348673-49348695 TGGCTGCAGGGGGCTCAGGAGGG - Intergenic
949763971 3:7505299-7505321 TGCCTGCAGTTGTCACAGGTTGG + Intronic
950099995 3:10350740-10350762 TGCCTGCCGTTGGCACAGGAAGG - Intronic
954627234 3:52029154-52029176 TGCCTGCACAGGGCACAGCTGGG - Intergenic
956912662 3:73835119-73835141 TGGCAGCAGCAGGCCCAGGTGGG - Intergenic
958710200 3:97708776-97708798 TGACTGGAGCTGGCACAGCTGGG - Intronic
959278882 3:104311570-104311592 AGCCTGCTGCTGGCAAAGGTAGG + Intergenic
961033852 3:123628839-123628861 CAGCTGCAGCAGGCACAGGTGGG + Intronic
961325374 3:126106224-126106246 AACCTGCGGCGGGCACATGTGGG - Intronic
962217949 3:133538964-133538986 TGCATGCAGAGGCCACATGTAGG + Intergenic
964669341 3:159208368-159208390 TGCCTGCAGAGTCCACAGATTGG + Intronic
967777261 3:193397230-193397252 TGCTTGTAGCAGGCCCAGGTGGG + Intergenic
968442921 4:633674-633696 GACCTGCAGTGGGCACAGGGTGG - Intronic
968903983 4:3443403-3443425 CGCCTCCAGGGGGCCCAGGTGGG + Exonic
969619161 4:8270261-8270283 CGCCTGCAGCGCGCACACGTTGG - Exonic
969629180 4:8325579-8325601 GGCCTGCAGTGCGGACAGGTTGG - Intergenic
970155508 4:13137646-13137668 TACCTGCACAGGCCACAGGTGGG - Intergenic
972374291 4:38456315-38456337 TGGCTGCACCTGGCTCAGGTGGG + Intergenic
972675601 4:41257186-41257208 TGCCAGCAGCCGGAACCGGTGGG - Intronic
973162027 4:47031175-47031197 TGCCTGTGGCGGGCACCGGGAGG - Intronic
985486819 5:156546-156568 TGCCTGGAGGGGACCCAGGTGGG - Intronic
985937493 5:3108056-3108078 TGGCTGCAGTGAGGACAGGTGGG - Intergenic
988686520 5:33530516-33530538 AGGCTGGAGAGGGCACAGGTGGG + Intronic
989187094 5:38636115-38636137 TCACTGCAGCGGGCAGAGATGGG + Intergenic
990761150 5:59130980-59131002 TGCCTGCTGAGGGCATAGTTAGG - Intronic
998138159 5:139685186-139685208 TGCCAGCAGCGGGCGGAGGCAGG - Intergenic
1000121090 5:158198563-158198585 TGCCTGCAGCATTCACAGGAAGG + Intergenic
1000667770 5:164020169-164020191 TGCCTGAAACGGGCTCACGTGGG + Intergenic
1002309163 5:178304159-178304181 GGCCTGCAGCGGCCTCAGGGAGG + Intronic
1006276631 6:33009468-33009490 TGCCTCCTGCGGGCTCAGGAGGG + Exonic
1006581669 6:35081073-35081095 TGCCTCCAGGGGACACAGGCAGG + Exonic
1006958582 6:37902087-37902109 TGCCTGCAAAGGGTAAAGGTGGG + Intronic
1007119474 6:39368207-39368229 TGCCTGCATCGGGCCCTTGTAGG + Intronic
1007902334 6:45423162-45423184 GGGTGGCAGCGGGCACAGGTGGG - Intronic
1008789792 6:55216731-55216753 TGCCTGCAGCTTTCCCAGGTGGG + Intronic
1012439790 6:99252614-99252636 TGCCTGCTGTGGGCACGGCTAGG - Intergenic
1013293653 6:108739856-108739878 CGTCTGCAGCAGGCACAGGCTGG + Intergenic
1018565282 6:165145066-165145088 TGCCTGCAGCTGAGACAGGAAGG + Intergenic
1019492039 7:1318820-1318842 TGCCTCCAGCCGGCATCGGTGGG - Intergenic
1020080518 7:5283612-5283634 TGCATGCAGGGGCCACAGGCTGG - Intronic
1022099196 7:27159090-27159112 AGCCTGAAGCAGGCACATGTAGG + Intergenic
1023235471 7:38081691-38081713 TGCCTGGAGCTGGAACAGCTGGG + Intergenic
1024074229 7:45810613-45810635 GGCCTGCAGAGGGCACCGGGAGG - Intergenic
1024273610 7:47660099-47660121 TGCCTGCTGAGGCGACAGGTAGG - Exonic
1025198401 7:56948568-56948590 TGCATGCAGGGGCCACAGGCTGG + Intergenic
1025673549 7:63628365-63628387 TGCATGCAGGGGCCACAGGCTGG - Intergenic
1025959035 7:66204867-66204889 TGCCAGCAGCGGGCAAAGGTGGG + Intergenic
1026953957 7:74365257-74365279 TGACTGCAGCTGGCACAGGGGGG - Intronic
1027742458 7:82027854-82027876 TCCCTGAAGCTGGCAGAGGTTGG + Intronic
1032279708 7:130491027-130491049 TGGATGCAGCGGGCACCGGCCGG + Intronic
1032487298 7:132297390-132297412 TGTCTGCAGCAGGCAAAGGAAGG - Intronic
1033473134 7:141666855-141666877 TGTCTGCAGAAGTCACAGGTAGG + Intronic
1034445395 7:151111419-151111441 GGGCTGCAGCGGGCACAGCCAGG + Intronic
1036386530 8:8286563-8286585 TGCCTGTAGCAGGCAGAGGTTGG + Intergenic
1036496810 8:9277372-9277394 TGGCTGCACAGGGCACAGGAGGG - Intergenic
1036695895 8:10975023-10975045 TGCCAGCAAGGGGCAGAGGTGGG - Intronic
1036877682 8:12487362-12487384 TGGTTGCAGCGGGCTCAGATGGG + Intergenic
1037683630 8:21119224-21119246 TGGCTGCAGGAGGCACAGGCAGG - Intergenic
1038762196 8:30394670-30394692 ATCCTGCAGCAGGCACAGGACGG - Intronic
1041268205 8:56085222-56085244 GGCCTGAAGCAGGAACAGGTTGG + Intergenic
1041971861 8:63752587-63752609 TGCCTGCATCCTGTACAGGTTGG + Intergenic
1044838950 8:96322020-96322042 TGACTGCAGGGGGCAGAGGTGGG + Intronic
1046138453 8:110061046-110061068 TGCCTGCTGCGGGCACACCCAGG - Intergenic
1046934582 8:119874010-119874032 GGACTGCAGCGGGCACGCGTTGG - Intronic
1049171772 8:141165945-141165967 TGACTGCAGCAGACACATGTTGG - Intronic
1051371572 9:16363718-16363740 TGCCTGCTGCAGGCACAGGCAGG - Intergenic
1051593985 9:18805680-18805702 TGCCTGCAGGGGGCAGGGGCAGG - Intronic
1052707413 9:32010497-32010519 TGGCTGCAGCTGAGACAGGTGGG - Intergenic
1053430222 9:38037353-38037375 TGACTGGAGCGGGCAGTGGTGGG - Intronic
1053449627 9:38182074-38182096 TTCATGCAGCAGGCACAGCTGGG - Intergenic
1057274441 9:93668832-93668854 TGCCTGCAGCGGGCTGAGGGGGG - Intronic
1057546015 9:96021062-96021084 CGCCTGCGCCGGGCACAGGGAGG + Intergenic
1058854611 9:109048942-109048964 TCCTTGCAGAGGGCACAGCTTGG + Intronic
1059656165 9:116359694-116359716 TGCATGCAGAGGGCACAGCAAGG + Intronic
1060731765 9:126041905-126041927 TGCCTGCTGTGGGCACATGTGGG + Intergenic
1060780442 9:126408447-126408469 TGCCTGCAGTGGGCCCAGGCAGG + Intronic
1060940825 9:127542012-127542034 TGGCTGCGGCGGGCACAGGACGG - Intronic
1061926494 9:133808456-133808478 TGCCTACAGGAGGCCCAGGTGGG + Intronic
1061940244 9:133880118-133880140 TTCCTGCAGACGGCGCAGGTGGG - Intronic
1062001100 9:134216176-134216198 AGCCTGCAACGGGCCCAGCTGGG + Intergenic
1062394440 9:136347080-136347102 TGCCTGCATCAGGCAGATGTCGG - Intronic
1062512915 9:136917334-136917356 TGCCTGGGGTGGGCACAAGTGGG - Intronic
1187238038 X:17486698-17486720 TGCCTTCAGTGGGAACAGGAGGG + Intronic
1187333378 X:18360999-18361021 TGGCTGGAGCGGGCAGAGGCTGG + Intergenic
1188468332 X:30508228-30508250 GGCCTACAGATGGCACAGGTAGG + Intergenic
1189014778 X:37085917-37085939 ATCCTGCAGCAGGCACAGGACGG - Intergenic
1189850541 X:45172398-45172420 TGACAGCAAGGGGCACAGGTAGG - Intronic
1196723419 X:118875612-118875634 TGCCTGCAGCTTTCCCAGGTTGG - Intergenic
1197207057 X:123799410-123799432 TGCCTGGAGGTGGCATAGGTTGG + Intergenic
1197614478 X:128675980-128676002 TGCCTCCAGCATGCACAGGACGG - Intergenic
1197643447 X:128992586-128992608 TGCCTGCAGGTGGCAGATGTGGG + Intergenic
1198087179 X:133292731-133292753 CTCCTGCAGTGGGCACAGGTTGG - Intergenic
1201765190 Y:17568671-17568693 TCCCGGCTGCGGGCACAGGGTGG - Intergenic
1201836362 Y:18337318-18337340 TCCCGGCTGCGGGCACAGGGTGG + Intergenic