ID: 1142171555

View in Genome Browser
Species Human (GRCh38)
Location 16:88625179-88625201
Sequence CTGTAATACAAGCAACAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 134}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142171555_1142171563 10 Left 1142171555 16:88625179-88625201 CCCCGCTGTTGCTTGTATTACAG 0: 1
1: 0
2: 0
3: 6
4: 134
Right 1142171563 16:88625212-88625234 AGCGGCAGCGGCAGTGGCAGTGG 0: 4
1: 22
2: 89
3: 514
4: 1807
1142171555_1142171564 25 Left 1142171555 16:88625179-88625201 CCCCGCTGTTGCTTGTATTACAG 0: 1
1: 0
2: 0
3: 6
4: 134
Right 1142171564 16:88625227-88625249 GGCAGTGGTAGCAGCTATAGTGG 0: 1
1: 0
2: 0
3: 15
4: 181
1142171555_1142171560 -8 Left 1142171555 16:88625179-88625201 CCCCGCTGTTGCTTGTATTACAG 0: 1
1: 0
2: 0
3: 6
4: 134
Right 1142171560 16:88625194-88625216 TATTACAGGCGGACGCTAAGCGG 0: 1
1: 0
2: 0
3: 0
4: 26
1142171555_1142171562 4 Left 1142171555 16:88625179-88625201 CCCCGCTGTTGCTTGTATTACAG 0: 1
1: 0
2: 0
3: 6
4: 134
Right 1142171562 16:88625206-88625228 ACGCTAAGCGGCAGCGGCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 89
1142171555_1142171561 -2 Left 1142171555 16:88625179-88625201 CCCCGCTGTTGCTTGTATTACAG 0: 1
1: 0
2: 0
3: 6
4: 134
Right 1142171561 16:88625200-88625222 AGGCGGACGCTAAGCGGCAGCGG 0: 1
1: 0
2: 0
3: 0
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142171555 Original CRISPR CTGTAATACAAGCAACAGCG GGG (reversed) Intronic
900738721 1:4317342-4317364 CTGTAAGCCAAGAAACAGCTAGG + Intergenic
904289164 1:29472592-29472614 CTTTGATACATGCAACAGCTGGG - Intergenic
905575134 1:39038010-39038032 CTGTAATCCCAGCTACAGGGAGG - Intergenic
908465590 1:64390395-64390417 CTTTAATACAGACAACAGTGGGG + Intergenic
912835855 1:112995798-112995820 CTGTAATCCCAGCTACAGGGAGG + Intergenic
914733928 1:150398125-150398147 CTGTAATTCCAGCTACTGCGGGG - Intronic
915122890 1:153642684-153642706 CTTTGATTCAAGCAACAGCAGGG - Intronic
915205950 1:154270463-154270485 CTATAATACATACAACAGGGTGG - Exonic
915436223 1:155908683-155908705 CTGTAATCCCAGCTACTGCGGGG - Intronic
915515030 1:156407728-156407750 CTGTTATACAAGCAAGAGTCAGG - Intronic
915635234 1:157181699-157181721 CTGTAATAAAAGCAGGAGCTTGG + Intergenic
915940422 1:160115279-160115301 CTATAATAGAAGGAACAGAGTGG + Intergenic
919883933 1:201919144-201919166 CTGTAATCCCAGCAAAAGTGAGG - Intronic
1063111898 10:3045355-3045377 TTGTAAGACAAACAGCAGCGTGG - Intergenic
1063271125 10:4510681-4510703 CTGTGATAAAAGGAACGGCGAGG + Intergenic
1064654613 10:17544817-17544839 CTGTAATCCCAGCTACAACGAGG + Intergenic
1065868724 10:29936929-29936951 CTGTAATACCAGCTACTGGGAGG - Intergenic
1070988666 10:80711787-80711809 CTGAAACACAAGAAACAGCTTGG - Intergenic
1073315732 10:102579426-102579448 CTGGAATACAAGTCACAGCAGGG - Intronic
1073671135 10:105591413-105591435 ATGTAATACAGTCAACAGTGAGG - Intergenic
1077513200 11:2982896-2982918 CTGTAATCCCAGCAACTGGGAGG + Intronic
1090837477 11:130463837-130463859 CTGTGATACAAGACACAGAGAGG + Intronic
1094175312 12:27535448-27535470 CTGTCACCCAAGCTACAGCGAGG + Intronic
1095420002 12:42015617-42015639 CTGTAATCCCAGCTACAGGGGGG - Intergenic
1096431916 12:51551813-51551835 CTGAAATACACGCAAAAGCAAGG - Intergenic
1100449063 12:94688075-94688097 CTGTAATCCCAGCAACTGGGAGG - Intergenic
1101115327 12:101525810-101525832 CTGTAATCCCAGCTACAGGGAGG + Intergenic
1101748214 12:107560413-107560435 CTGGAAAAAAAGCAACAGCTGGG - Intronic
1101920209 12:108926175-108926197 CTGTAATACCAGCAATTGGGAGG - Intronic
1109382858 13:61587055-61587077 CTGTAATAGAATCATCAGCTTGG - Intergenic
1111035821 13:82672206-82672228 ATGTAATACTAGCAACACTGTGG - Intergenic
1111847518 13:93530186-93530208 CTGAAATAGAAGCAACAGTCTGG + Intronic
1122166866 14:99832184-99832206 CATTGATACAAGCAACAGCACGG - Intronic
1128135159 15:65257506-65257528 CTGTAATCCCAGCTACAGGGAGG + Intronic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1128919334 15:71596013-71596035 CTGGAAAAGAAGCAACAGTGAGG - Intronic
1133692562 16:8230682-8230704 CTGTCATACACGCCACAGCAGGG + Intergenic
1136132625 16:28233338-28233360 CTGTAATCCCAGCTACAGGGTGG + Intergenic
1137430040 16:48411279-48411301 CTGTAATCCCAGCTACAGGGAGG + Intronic
1137811479 16:51356917-51356939 CTGTAAAAGAAGCAACACCCCGG - Intergenic
1138101812 16:54258013-54258035 CTGTTATACAAGCCACAAGGAGG - Intronic
1138925867 16:61590771-61590793 CTGTCACACTAGCAACAGGGGGG - Intergenic
1140354451 16:74293414-74293436 CTGTAATCCCAGCACCAGCCTGG + Intergenic
1141092784 16:81141580-81141602 CTGCAATACAAACAACAGCCAGG + Intergenic
1141209735 16:81966302-81966324 CTGTACAACAAGCCACAGAGCGG + Intergenic
1142171555 16:88625179-88625201 CTGTAATACAAGCAACAGCGGGG - Intronic
1146945621 17:36871099-36871121 CTGTATTACAAGCATCAGCTTGG + Intergenic
1148832031 17:50440057-50440079 CTAAAAGACAAGCAACAGCCTGG - Intronic
1155377534 18:25176766-25176788 CTGTAAGGAAAGCAACACCGGGG - Intronic
1156011951 18:32506394-32506416 CTATAATACAAGCATAAGCCAGG - Intergenic
1159795646 18:72840012-72840034 CTATAAGACAAGCTACAGAGAGG - Intronic
1161050772 19:2163194-2163216 CTGTAATCCCAGCTACTGCGGGG - Intronic
1161812866 19:6480725-6480747 CTGTAATCCCAGCTACAGGGAGG - Intronic
1163196598 19:15726070-15726092 CAGTGATACATGCAACAGCGTGG - Intergenic
1166661244 19:44648601-44648623 CTGTAATTCCAGCTACAGGGAGG - Intronic
1167838148 19:52092017-52092039 CTGTAATACCAGCTACTACGGGG + Intronic
933764180 2:85695770-85695792 CTCTAAGACAAGCAAAAGGGTGG + Intronic
938908781 2:135865641-135865663 CTTTAAAACAAAAAACAGCGTGG + Intronic
944448934 2:199821270-199821292 CTGTAATCCAAGCTACATGGTGG - Intronic
944884742 2:204050866-204050888 CTGCAAAACAAGCCACAGCTTGG - Intergenic
947086911 2:226463682-226463704 TATTAATACAAGCAACAGCATGG + Intergenic
947883031 2:233537138-233537160 CTGTAATCCCAGCAAAAGGGAGG - Intronic
948226428 2:236313743-236313765 CTTTAATACATGCAACAACATGG + Intergenic
948691856 2:239711290-239711312 CTGTTATACAAGCAGAAGCCTGG + Intergenic
1169162207 20:3390485-3390507 CTGTAATCCCAGCTACAGGGAGG - Intronic
1174004028 20:47396020-47396042 CTGTAATCCCAGCTACAGGGAGG - Intergenic
1176894245 21:14357253-14357275 TTGTAAGACAAGAAACAGCCAGG - Intergenic
1177687112 21:24451331-24451353 CTGTAATCCCAGCTACAGGGAGG - Intergenic
1178685400 21:34706728-34706750 CTATTATACAAGCAACAGTGTGG - Intronic
1184845810 22:47085156-47085178 CTGTAATTCCAGCAACACAGAGG + Intronic
949347491 3:3090183-3090205 CTGAAATAAAAACAACAGCAGGG - Intronic
951710236 3:25579519-25579541 CTGTAATACATGCTACAACATGG - Intronic
951721593 3:25704476-25704498 CAGTAATAAAAGCAGCAGGGAGG + Intergenic
952603940 3:35121073-35121095 CTGGAAGACAAGCAACAGGAAGG + Intergenic
957835222 3:85578957-85578979 CTTTAATACTTGCAACACCGTGG - Intronic
962235681 3:133705150-133705172 CTGTAATCCCAGCTACAGGGAGG + Intergenic
966358402 3:179107149-179107171 CTGTAATCCCAGCTACTGCGTGG + Intergenic
968179406 3:196580579-196580601 CTGTAATCCCAGCAACTGGGAGG - Intronic
968190973 3:196666871-196666893 CTGTAATCCCAGCTACTGCGGGG + Intronic
969870219 4:10099911-10099933 TTGTAACAGAAGCAACACCGGGG + Intronic
970577375 4:17440676-17440698 CTGTAATCCCAGCTACAGGGAGG + Intergenic
972400876 4:38702447-38702469 CTGTAATTCCAGCAACTACGGGG - Intergenic
973131363 4:46652787-46652809 CTGTAATGCAAGCAATGGAGAGG + Intergenic
973175561 4:47200868-47200890 TTGAAATACAAGTAACAGGGAGG - Intronic
979360778 4:119762356-119762378 ATTTTATACAAGCAACAGCAGGG + Intergenic
979468384 4:121068407-121068429 ATTTAATAGAAGCCACAGCGTGG - Intronic
981090956 4:140731592-140731614 CTATAAGACACGCAACAGCTTGG - Intronic
981267417 4:142803045-142803067 CTGTAATCCCAGCTACAGGGCGG + Intronic
982194066 4:152891828-152891850 CTGTAATTCCAGCTACAGAGAGG - Intronic
987188387 5:15448487-15448509 CTGTAATTCAAGCACCAACTTGG + Intergenic
988985989 5:36619380-36619402 CTGTAATACCAGCAACTCAGGGG + Intronic
991334639 5:65533226-65533248 CTGTAATCCAAGCTACTGGGAGG + Intronic
992326051 5:75661272-75661294 CTGTAATCCCAGCTACAGCGGGG + Intronic
993619827 5:90155009-90155031 CTATAAATCAAGGAACAGCGAGG + Intergenic
994921245 5:106046801-106046823 CTGTAAGCCAAGAAACAGCAAGG + Intergenic
996430044 5:123364530-123364552 CTGCATTACAAGCAGCAGTGGGG - Exonic
997081044 5:130738164-130738186 CTGTAATCCAAAAAACAGAGAGG + Intergenic
999105862 5:149070424-149070446 CAGTAATGCAAGCAAAAGTGTGG + Intergenic
1000314108 5:160072468-160072490 CTGTAATCCCAGCACCTGCGGGG + Intronic
1002977590 6:2098179-2098201 CTGTAATCCCAGCTACAGGGAGG - Intronic
1004107281 6:12677474-12677496 CTGTAATCCCAGCAAAAGTGAGG - Intergenic
1005373206 6:25156089-25156111 CTGTAGTACCAGCTACAGCTTGG + Intergenic
1009403690 6:63287434-63287456 CTGTAATACCAGCAGGAGTGAGG + Intronic
1011313989 6:86011043-86011065 CTGTAATCCCAGCTATAGCGGGG + Intergenic
1011684112 6:89810606-89810628 CTGTGAGACAAGGAACAGCAGGG - Intronic
1011797919 6:90977970-90977992 CTGCAAAACAAGGAACAGCAAGG + Intergenic
1012552822 6:100479997-100480019 ATGTAATACAAGTAAAAGCATGG + Intergenic
1012746379 6:103094906-103094928 TTATAATATAAGCAACAGCCAGG + Intergenic
1012954329 6:105552764-105552786 CTGTAATATCAGCATTAGCGTGG - Intergenic
1013318528 6:108964112-108964134 CTGTAAAACAAGAGACAGCTGGG + Intronic
1015763747 6:136693239-136693261 CTGGAATACAAGAGACAGCCTGG - Intronic
1018178985 6:161203691-161203713 CTGTAATCCCAGCACCAGCCGGG - Intronic
1019086965 6:169487486-169487508 CTGTAATCCAGGGAGCAGCGAGG - Intronic
1022059274 7:26774848-26774870 CTGCAATAAAAGGAACAGCCCGG + Intronic
1025262679 7:57430327-57430349 CTGTAATCCCAGCTACTGCGGGG - Intergenic
1026768946 7:73181158-73181180 CTGTAATCCCAGCTACAGGGAGG - Intergenic
1027009815 7:74734542-74734564 CTGTAATCCCAGCTACAGGGAGG - Intronic
1027078227 7:75211496-75211518 CTGTAATCCCAGCTACAGGGAGG + Intergenic
1027149919 7:75725941-75725963 CTGTAATCCCAGCTACAGGGAGG - Intronic
1028416169 7:90582871-90582893 CTGTAATCCCAGCATCAGGGAGG - Intronic
1030463100 7:109865354-109865376 CTGTAATAAAATCAACAGAGGGG - Intergenic
1030876592 7:114820564-114820586 CTGTAATCCCAGCTACTGCGGGG + Intergenic
1041493317 8:58459540-58459562 CTGTAAGACAAGGAACTGTGTGG + Intergenic
1043213695 8:77558291-77558313 CTGTAGTAAAAACAACAGCATGG + Intergenic
1043818775 8:84837653-84837675 CAGTAATAAAAGAAACAGTGTGG + Intronic
1045698583 8:104839442-104839464 CTGTAATCCCAGCTACAGAGTGG - Intronic
1047718071 8:127613966-127613988 CTGTAATCCCAGCTACAGGGTGG + Intergenic
1048265068 8:132978536-132978558 CAGTAATACAAGCCACATCACGG - Intronic
1049924677 9:397227-397249 CTGTAATCCCAGCAACTGGGAGG + Intronic
1050233095 9:3549400-3549422 CTGTAAAACAAGGAAAAGAGAGG - Intergenic
1055368278 9:75569656-75569678 CTGTAATCCCAGCTACAGGGAGG + Intergenic
1056072368 9:83000954-83000976 GTGGAATACAAGCACCAGAGGGG - Exonic
1059091135 9:111359647-111359669 CTGTCATACAAGCAACTGATTGG - Intergenic
1059726388 9:117012557-117012579 CTTTAATACAACCTACAGTGTGG + Intronic
1060974753 9:127758228-127758250 CTGTAATCCCAGCAACTGGGAGG - Intronic
1190087033 X:47404285-47404307 CTGTAATCCCAGCTACAGGGAGG - Intronic
1190878456 X:54475941-54475963 CTGTAATACCAGCTACCGGGAGG + Intronic
1201903844 Y:19069509-19069531 CTGTAATTCCAGCACCATCGGGG + Intergenic
1202231708 Y:22665310-22665332 ATGTAATGCAAGCAAAGGCGTGG - Intergenic
1202311450 Y:23530855-23530877 ATGTAATGCAAGCAAAGGCGTGG + Intergenic
1202559352 Y:26139739-26139761 ATGTAATGCAAGCAAAGGCGTGG - Intergenic