ID: 1142172523

View in Genome Browser
Species Human (GRCh38)
Location 16:88630434-88630456
Sequence GCCATTCCCTGTACATCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142172518_1142172523 4 Left 1142172518 16:88630407-88630429 CCTGGCATCGGTGAGGCCACCCA 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1142172523 16:88630434-88630456 GCCATTCCCTGTACATCAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 113
1142172517_1142172523 5 Left 1142172517 16:88630406-88630428 CCCTGGCATCGGTGAGGCCACCC 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1142172523 16:88630434-88630456 GCCATTCCCTGTACATCAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 113
1142172513_1142172523 26 Left 1142172513 16:88630385-88630407 CCTCAGGCTTTAGAAGTGAGTCC 0: 1
1: 0
2: 0
3: 10
4: 127
Right 1142172523 16:88630434-88630456 GCCATTCCCTGTACATCAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142172523 Original CRISPR GCCATTCCCTGTACATCAGG AGG Intronic
901201009 1:7467439-7467461 GCCATTCCCTGTACCCCAAAGGG + Intronic
906286755 1:44592628-44592650 GCAAGTCCCTGTGCTTCAGGTGG + Intronic
910926031 1:92399094-92399116 GCCATTCCCTTTAAATGAGCTGG + Exonic
911415043 1:97561257-97561279 ACCATTCCCTGAACAGAAGGAGG + Intronic
912879309 1:113391788-113391810 GCCCTTCCAGGTACACCAGGTGG - Intronic
921173460 1:212570041-212570063 GCCTTTGCCTGTACATCTGTTGG + Intronic
921511515 1:216036794-216036816 GCAATTGCCTGTAGATCAGAGGG + Intronic
921935513 1:220792261-220792283 GCCCTTCCCTCAACATCAGAAGG + Intronic
1062978453 10:1702079-1702101 GCCATTCCCTGAAGATGAGGTGG + Intronic
1064528359 10:16281968-16281990 GCCATATCCTGTACATGATGTGG + Intergenic
1065012998 10:21436416-21436438 GCCAGTCCCTGTGGCTCAGGGGG + Intergenic
1065360892 10:24888015-24888037 GTCATTCCCAGTAACTCAGGAGG - Intronic
1067059599 10:43071128-43071150 TCCATTCCCCGTACATCTAGGGG - Intergenic
1069855779 10:71440192-71440214 GCCAGTCCCTGCACCCCAGGAGG - Intronic
1070351699 10:75598964-75598986 TGCATTCCTTGTCCATCAGGTGG + Intronic
1070669888 10:78370365-78370387 GCCAGATCCTGTGCATCAGGAGG + Intergenic
1071180317 10:82976649-82976671 GCCTTGCCCTGTACACCAAGAGG + Intronic
1072525986 10:96272094-96272116 GCAATTCTCTGTTCATCTGGGGG + Intergenic
1076863440 10:133154613-133154635 GCTATTCCCTGTTGTTCAGGAGG + Intergenic
1082718092 11:56640041-56640063 GCCATCCACTGTAGACCAGGAGG - Intergenic
1084205404 11:67588836-67588858 GCCAATCCCAGCACTTCAGGAGG + Intergenic
1086294246 11:85347265-85347287 GCCCCTCCCTGTGCTTCAGGGGG - Intronic
1086357549 11:86019717-86019739 GCCATTCCAAATCCATCAGGAGG - Intronic
1090787356 11:130061657-130061679 CTCATTCCCTGTACTTCAGTCGG - Intergenic
1091649481 12:2299249-2299271 GGCCCTCCCTGGACATCAGGGGG + Intronic
1092150135 12:6242223-6242245 ACAATTCCCTGTACACCTGGAGG - Intergenic
1096628698 12:52911466-52911488 GGCCTTTACTGTACATCAGGGGG + Intronic
1097913716 12:64997947-64997969 CCCATTTCCTGTACTTCAGCTGG + Intergenic
1106074496 13:26446176-26446198 GCCATTCCCTTTCCATCAATAGG - Intergenic
1109697796 13:65983569-65983591 TCCATTCCATGTATATCTGGAGG - Intergenic
1113227204 13:108172332-108172354 GCTCTTCCTTGTACATCTGGTGG - Intergenic
1115046483 14:29001040-29001062 GCCTCTGCCAGTACATCAGGTGG - Intergenic
1117294262 14:54364655-54364677 GGCATGCCCTGTACAGCAGTGGG - Intergenic
1118163730 14:63316043-63316065 GCCAGTCCCTGAACAGGAGGAGG + Intronic
1120533663 14:85665535-85665557 ATTATTCCCTGTACATCAGAAGG - Intergenic
1122309403 14:100785075-100785097 CCCATTCCCTGCCCATCTGGTGG + Intergenic
1122645403 14:103190053-103190075 GCCTTTCCCTGTACAGGCGGAGG - Intergenic
1123145785 14:106128835-106128857 CCCATTCCCTGCAGCTCAGGTGG - Intergenic
1123186039 14:106517874-106517896 CCCATTCCCTGCAGCTCAGGCGG - Intergenic
1124087411 15:26563752-26563774 GCCATTTCCTGTACTGCAGCTGG - Intronic
1125421265 15:39507038-39507060 ACTATTCCCTGAACATTAGGGGG - Intergenic
1127668992 15:61176412-61176434 TCCATTTCCTGTACATCAGATGG + Intronic
1132720829 16:1314826-1314848 GCCAGTCCCTGTGCCCCAGGAGG - Intronic
1133631907 16:7629776-7629798 GCCCTTCGCTTTAAATCAGGAGG + Intronic
1134586761 16:15418247-15418269 GCCAAGCCCTTTACATCATGTGG + Intronic
1135051216 16:19194502-19194524 ACCTTTTCCTGTACATCAGCAGG - Intronic
1138246091 16:55468179-55468201 GCCATTTCCTGTGCTTCTGGGGG - Intronic
1138250502 16:55498363-55498385 TCCACTCGCTGGACATCAGGGGG - Exonic
1139747622 16:69087247-69087269 GCCATCCCCTGTAGAGCAAGGGG - Intergenic
1141303520 16:82839495-82839517 GACAGTCCCAGTAAATCAGGAGG + Intronic
1142172523 16:88630434-88630456 GCCATTCCCTGTACATCAGGAGG + Intronic
1143319307 17:6057751-6057773 GCCAGTCCCTGTTCCTCTGGTGG - Intronic
1144725890 17:17502661-17502683 ACCAGTACCTGTTCATCAGGGGG - Intergenic
1149654712 17:58304217-58304239 GCCATTCCCTGGACTACAGTGGG + Intronic
1150490966 17:65574070-65574092 GGTATTCCCTGGGCATCAGGGGG - Intronic
1152416885 17:80168480-80168502 GCCATTCCCAGTAAAAGAGGGGG - Intergenic
1163293710 19:16398251-16398273 ACCATTCCATGTTCATCAGATGG - Intronic
1166166416 19:40992481-40992503 GCCATTCTTTGTACATCCAGTGG - Intronic
926097827 2:10093943-10093965 TCCATGCCCTGTCCATCAAGTGG - Intergenic
926258904 2:11238308-11238330 TCCAATCCGTGTACATGAGGTGG - Intronic
929575658 2:43050246-43050268 TCCATTCCCTGTACATCCCTTGG - Intergenic
931254803 2:60561053-60561075 GCCACTCCATAAACATCAGGTGG + Intergenic
932708817 2:74047423-74047445 CCCATCCCCTGTACTTCAGAGGG + Exonic
933107390 2:78348713-78348735 ACCTTTACCTGCACATCAGGAGG - Intergenic
935042057 2:99441388-99441410 GCCTTACCTTGTATATCAGGTGG - Intronic
940101422 2:150043623-150043645 GAAATTCCCTGTACAAAAGGAGG + Intergenic
948487823 2:238291858-238291880 GCCTGTCCCTGGACATGAGGTGG + Intergenic
1175345195 20:58268133-58268155 GCCCTTCTCTGTTCATCAGCAGG - Intergenic
1175909209 20:62396665-62396687 GCCCTTCCCTGCACAGCGGGCGG - Intronic
1179663924 21:42896575-42896597 GCCAATCCCAGCACTTCAGGAGG + Intronic
1179914880 21:44470195-44470217 TCCATTCCCAATACCTCAGGAGG - Intergenic
1182256922 22:29045905-29045927 GCCTGTCCCAGTACATCAAGTGG + Intronic
1182272176 22:29161603-29161625 GCTCTTCCTTGTACATCTGGTGG - Intronic
950914410 3:16629223-16629245 GCCCTTCCCTGCATTTCAGGGGG - Intronic
950964795 3:17138750-17138772 GCCATTCCCTGGCCCTGAGGGGG + Intergenic
951842347 3:27047860-27047882 GGCACTCCCTGTAATTCAGGAGG - Intergenic
952226700 3:31383916-31383938 GCCATGCCCTGAAGATCTGGAGG - Intergenic
960663997 3:120093238-120093260 TCCATTGCCTGTTTATCAGGAGG + Intronic
964213680 3:154255693-154255715 GCTATTCTGTGTACCTCAGGAGG - Exonic
967989212 3:195118919-195118941 GTCATTAGCTGTACATCAGCAGG + Intronic
972065703 4:34940458-34940480 GCCAGTCACTGTACATCTGCTGG - Intergenic
973656517 4:53053714-53053736 GCCATTCCCTGAGGAACAGGAGG - Intronic
978377790 4:108094085-108094107 CTCATTACCTGTACATCATGTGG + Intronic
980879991 4:138700302-138700324 GTCATTTCCTGTGCTTCAGGTGG - Intergenic
981913371 4:150008112-150008134 GCACTTCCCTGAGCATCAGGAGG + Intergenic
982569041 4:157025577-157025599 GCCAGTCCCCGGACAACAGGTGG + Intergenic
991923639 5:71682715-71682737 GGCATTTACTGTACATCAAGTGG + Intergenic
996064031 5:119062205-119062227 TTCATTCCCTGTACAGCAGAAGG - Intronic
997686850 5:135794849-135794871 ATCATTCCCAGTATATCAGGGGG + Intergenic
997886067 5:137630811-137630833 GCCATTGCCTGGAAGTCAGGAGG - Intronic
998600002 5:143575817-143575839 GCCTTTCTCTGTGCCTCAGGAGG + Intergenic
1001315854 5:170640878-170640900 CCCATTCACTGTGCATCAGAAGG - Intronic
1006899188 6:37489346-37489368 GCCATTCCCAGTCCATGAAGAGG + Intronic
1007015399 6:38461073-38461095 GCCATTCCCTTTACCCCAAGAGG - Intronic
1011942777 6:92863620-92863642 TATATTCCCTGTAGATCAGGCGG - Intergenic
1014132018 6:117845945-117845967 GCATTTCCCAGGACATCAGGAGG - Intergenic
1015155765 6:130094310-130094332 GCCAATCCCTTTACATCCCGGGG - Exonic
1018865233 6:167742091-167742113 TCCTTTCCCTGTAGATCATGGGG + Intergenic
1018924572 6:168197394-168197416 CCCCTTCCCTATGCATCAGGTGG + Intergenic
1020261324 7:6532109-6532131 GCCATCCCCTGAACAGCAGCAGG + Intronic
1021674592 7:23067610-23067632 GCCATTCCCTGGACAACAAGAGG - Intergenic
1023515350 7:40996276-40996298 AACATTCCCTGTGCATCTGGAGG + Intergenic
1023585693 7:41727282-41727304 GTCATTCCCAGTACAGCAGAAGG + Intergenic
1025256831 7:57389498-57389520 ACCATTTCCTGCACACCAGGCGG - Intergenic
1025734987 7:64138789-64138811 GACATTTCCTGTTCATCTGGTGG - Intronic
1029401883 7:100352090-100352112 CCCCTTCCCTGGACAGCAGGGGG - Intronic
1030086720 7:105822052-105822074 GCCCTTCCCTATACTTCAGCTGG + Intronic
1034068435 7:148159140-148159162 GCAATATCCTGCACATCAGGGGG - Intronic
1038270084 8:26067923-26067945 GCAATTCCCAGTAGAACAGGAGG - Intergenic
1044316695 8:90757409-90757431 GGCATGCCCTGTACCTCAGATGG - Intronic
1045688200 8:104733703-104733725 GCCCTTCCCTGTACCCCAGGAGG + Intronic
1055547121 9:77390027-77390049 GTCTTTCCCTTTACTTCAGGAGG + Intronic
1059585511 9:115601879-115601901 GCCTTTTTCTGTACATAAGGAGG - Intergenic
1059750556 9:117243753-117243775 GGCCTGCCCTGTACATCATGGGG - Intronic
1185998686 X:4983859-4983881 GCCATTCCCTATAGTTAAGGGGG - Intergenic
1186497049 X:10019702-10019724 TCCATTTCCTGTAGCTCAGGTGG + Intronic
1187822156 X:23299093-23299115 TCCAGTCCCTGTCCATCATGTGG - Intergenic
1195735085 X:108004359-108004381 GCTATTCTTTGTACATCTGGTGG - Intergenic