ID: 1142173369

View in Genome Browser
Species Human (GRCh38)
Location 16:88634227-88634249
Sequence GTGCACCTGCGCCTTGATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142173365_1142173369 13 Left 1142173365 16:88634191-88634213 CCTGCGTTGTGGGCAGCCGGCAG No data
Right 1142173369 16:88634227-88634249 GTGCACCTGCGCCTTGATGTAGG No data
1142173361_1142173369 28 Left 1142173361 16:88634176-88634198 CCTCGGCTGGACACACCTGCGTT No data
Right 1142173369 16:88634227-88634249 GTGCACCTGCGCCTTGATGTAGG No data
1142173366_1142173369 -3 Left 1142173366 16:88634207-88634229 CCGGCAGCGCGTGACCCACTGTG No data
Right 1142173369 16:88634227-88634249 GTGCACCTGCGCCTTGATGTAGG No data
1142173360_1142173369 29 Left 1142173360 16:88634175-88634197 CCCTCGGCTGGACACACCTGCGT No data
Right 1142173369 16:88634227-88634249 GTGCACCTGCGCCTTGATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142173369 Original CRISPR GTGCACCTGCGCCTTGATGT AGG Intergenic