ID: 1142174909

View in Genome Browser
Species Human (GRCh38)
Location 16:88640686-88640708
Sequence CTCAAGGCACTGCTTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142174909_1142174914 9 Left 1142174909 16:88640686-88640708 CCTTCCTCAAGCAGTGCCTTGAG No data
Right 1142174914 16:88640718-88640740 TTGTAATGATGTGAGCGCCTAGG No data
1142174909_1142174915 10 Left 1142174909 16:88640686-88640708 CCTTCCTCAAGCAGTGCCTTGAG No data
Right 1142174915 16:88640719-88640741 TGTAATGATGTGAGCGCCTAGGG No data
1142174909_1142174917 22 Left 1142174909 16:88640686-88640708 CCTTCCTCAAGCAGTGCCTTGAG No data
Right 1142174917 16:88640731-88640753 AGCGCCTAGGGGCACCCTCTCGG No data
1142174909_1142174916 11 Left 1142174909 16:88640686-88640708 CCTTCCTCAAGCAGTGCCTTGAG No data
Right 1142174916 16:88640720-88640742 GTAATGATGTGAGCGCCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142174909 Original CRISPR CTCAAGGCACTGCTTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr