ID: 1142175499

View in Genome Browser
Species Human (GRCh38)
Location 16:88643269-88643291
Sequence GGAGCGCGTGAGCCTCTGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 132}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142175499_1142175503 1 Left 1142175499 16:88643269-88643291 CCAGGCAGAGGCTCACGCGCTCC 0: 1
1: 0
2: 1
3: 12
4: 132
Right 1142175503 16:88643293-88643315 GGCTTCGCTGCATTTATTGCAGG 0: 1
1: 0
2: 1
3: 3
4: 64
1142175499_1142175507 17 Left 1142175499 16:88643269-88643291 CCAGGCAGAGGCTCACGCGCTCC 0: 1
1: 0
2: 1
3: 12
4: 132
Right 1142175507 16:88643309-88643331 TTGCAGGTGGGTGCACCTGGCGG 0: 1
1: 0
2: 1
3: 18
4: 246
1142175499_1142175508 18 Left 1142175499 16:88643269-88643291 CCAGGCAGAGGCTCACGCGCTCC 0: 1
1: 0
2: 1
3: 12
4: 132
Right 1142175508 16:88643310-88643332 TGCAGGTGGGTGCACCTGGCGGG 0: 1
1: 1
2: 2
3: 28
4: 283
1142175499_1142175505 5 Left 1142175499 16:88643269-88643291 CCAGGCAGAGGCTCACGCGCTCC 0: 1
1: 0
2: 1
3: 12
4: 132
Right 1142175505 16:88643297-88643319 TCGCTGCATTTATTGCAGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 71
1142175499_1142175510 22 Left 1142175499 16:88643269-88643291 CCAGGCAGAGGCTCACGCGCTCC 0: 1
1: 0
2: 1
3: 12
4: 132
Right 1142175510 16:88643314-88643336 GGTGGGTGCACCTGGCGGGAGGG 0: 1
1: 0
2: 0
3: 21
4: 216
1142175499_1142175511 26 Left 1142175499 16:88643269-88643291 CCAGGCAGAGGCTCACGCGCTCC 0: 1
1: 0
2: 1
3: 12
4: 132
Right 1142175511 16:88643318-88643340 GGTGCACCTGGCGGGAGGGCAGG 0: 1
1: 0
2: 4
3: 35
4: 356
1142175499_1142175509 21 Left 1142175499 16:88643269-88643291 CCAGGCAGAGGCTCACGCGCTCC 0: 1
1: 0
2: 1
3: 12
4: 132
Right 1142175509 16:88643313-88643335 AGGTGGGTGCACCTGGCGGGAGG 0: 1
1: 0
2: 2
3: 23
4: 265
1142175499_1142175506 14 Left 1142175499 16:88643269-88643291 CCAGGCAGAGGCTCACGCGCTCC 0: 1
1: 0
2: 1
3: 12
4: 132
Right 1142175506 16:88643306-88643328 TTATTGCAGGTGGGTGCACCTGG 0: 1
1: 0
2: 0
3: 13
4: 123
1142175499_1142175504 4 Left 1142175499 16:88643269-88643291 CCAGGCAGAGGCTCACGCGCTCC 0: 1
1: 0
2: 1
3: 12
4: 132
Right 1142175504 16:88643296-88643318 TTCGCTGCATTTATTGCAGGTGG 0: 1
1: 0
2: 0
3: 8
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142175499 Original CRISPR GGAGCGCGTGAGCCTCTGCC TGG (reversed) Exonic
900149070 1:1170457-1170479 GGAGGGAGGGAGCCTCTCCCAGG - Intergenic
900584413 1:3425559-3425581 GGAGCGCGTGTGCCCCTTCCAGG + Exonic
900656881 1:3762963-3762985 GGAGTGGGAGAGCATCTGCCTGG - Intronic
902841226 1:19075238-19075260 GGAGAGCCAGAGCCTTTGCCAGG - Intronic
903649039 1:24911955-24911977 GGAACGCTGGAGCCACTGCCAGG + Intronic
905208158 1:36354810-36354832 GGAGAGCCTGAGCCTCTTCCCGG - Intronic
905919248 1:41708448-41708470 GGAGGGCATGAGCCTAAGCCAGG + Intronic
922746729 1:228048368-228048390 GGAGCCCCTGAGCCTCGGCTTGG - Intronic
1062943058 10:1438891-1438913 GGGGCTCCTGAGTCTCTGCCAGG + Intronic
1062943089 10:1439027-1439049 GGGGCTCCTGAGTCTCTGCCAGG + Intronic
1064215833 10:13399735-13399757 TGATGGCGTGAGCCTCTGCAGGG + Intergenic
1066281064 10:33918750-33918772 AGGGTGGGTGAGCCTCTGCCAGG + Intergenic
1070427488 10:76303842-76303864 CGAGCGTGTTAGCCGCTGCCTGG - Intronic
1072358235 10:94633355-94633377 GAAGCTTGGGAGCCTCTGCCTGG + Intergenic
1074300818 10:112232095-112232117 GGAGGGGGTGGGCATCTGCCTGG - Intergenic
1081899761 11:46617791-46617813 GGAGCGCGGAACCCTCAGCCAGG + Exonic
1082192916 11:49268905-49268927 GGAGCTCCTGAGGCTCTGTCAGG - Intergenic
1083592342 11:63903111-63903133 GGAGCGGGCCAGCCTCGGCCAGG + Exonic
1084086288 11:66856842-66856864 GGGGCGCGCGCGCCTGTGCCAGG + Intronic
1084958283 11:72703028-72703050 GGAGCGCCTGGGTCTCAGCCAGG + Exonic
1085534977 11:77212230-77212252 AGAGCTCGGGAGGCTCTGCCGGG + Intronic
1089527670 11:119107694-119107716 GCAGCGGGTGAGCCCCAGCCGGG + Exonic
1090240186 11:125176241-125176263 GGAGGGGGTTGGCCTCTGCCAGG + Intronic
1091634053 12:2183985-2184007 GGAGAGGGCCAGCCTCTGCCTGG + Intronic
1096413163 12:51391565-51391587 GGAGCCCGCGACCCTCTCCCCGG - Intronic
1096674524 12:53219403-53219425 GGAGGGCGTGTGCCCCTGCGTGG - Intronic
1101597226 12:106178115-106178137 GGAGCACCTGGCCCTCTGCCTGG + Intergenic
1102427003 12:112851658-112851680 GGAGCTCATGGGCTTCTGCCAGG + Intronic
1104602085 12:130161391-130161413 GGAGCGCGTCAGCGCCTGCCCGG - Intergenic
1104627975 12:130375461-130375483 GGAGCTTGTGAAGCTCTGCCTGG - Intergenic
1104887180 12:132117514-132117536 GGAGGGCGTCAGCCTGTGACTGG - Intronic
1105411807 13:20177346-20177368 GGAGAGCGAGAGCCCCGGCCCGG + Intergenic
1114508053 14:23232787-23232809 GGGGGGGGTCAGCCTCTGCCCGG + Intronic
1118955685 14:70477898-70477920 GGTGGGGGTGCGCCTCTGCCCGG + Intergenic
1120780079 14:88479218-88479240 CGTGCGCGCGAGCCTCGGCCCGG - Exonic
1121006048 14:90491355-90491377 GAAGCGCATGAACCTGTGCCTGG + Intergenic
1121723866 14:96131808-96131830 CGAGAGGGTGAGCCTCTGGCTGG - Intergenic
1121956275 14:98216541-98216563 GGAGAGCTTGAGCCTCATCCAGG + Intergenic
1122264237 14:100539276-100539298 GGAGCGCGTGAGCCTGCACATGG - Exonic
1122692597 14:103538310-103538332 GGAGGGAGTGAGCAACTGCCGGG + Intergenic
1123108647 14:105854972-105854994 GGTGCACGTGAACCTCTCCCCGG + Intergenic
1124844155 15:33274642-33274664 AGAGAGCAAGAGCCTCTGCCTGG - Intergenic
1130557882 15:84935582-84935604 GGAGCGGGAGAGCAGCTGCCAGG - Intronic
1131055264 15:89371200-89371222 GGACTGCATGGGCCTCTGCCCGG + Intergenic
1133045614 16:3086916-3086938 GGAAGACGGGAGCCTCTGCCAGG - Intergenic
1133981336 16:10635304-10635326 GGAGCTCATGAGGCTCTTCCAGG + Intronic
1134675433 16:16086850-16086872 GCAGCGCGTGAGCCTGGCCCGGG + Exonic
1136115348 16:28091061-28091083 GGAGCGCCAGAGCCTGGGCCTGG - Intergenic
1136933503 16:34437852-34437874 GCCGCGCCGGAGCCTCTGCCGGG + Intergenic
1136971069 16:34973962-34973984 GCCGCGCCGGAGCCTCTGCCGGG - Intergenic
1142059396 16:88019789-88019811 GTGGCCCGTGAGCCTCTGTCAGG + Intronic
1142175499 16:88643269-88643291 GGAGCGCGTGAGCCTCTGCCTGG - Exonic
1143949032 17:10618428-10618450 GGAGCACGGGAGCCTCTGCATGG + Intergenic
1148150411 17:45393727-45393749 TGTGCCCGTGAGCCTCTGCTTGG + Intergenic
1148685081 17:49496448-49496470 GGAGCGGGTGTGCCCCTACCCGG + Intronic
1150137677 17:62704401-62704423 GGAGCCCGGGAGCCCCAGCCCGG - Intronic
1151433880 17:74082203-74082225 TGAGCGCTGGATCCTCTGCCTGG - Intergenic
1151724851 17:75877942-75877964 GGAGCGCGTGTGTCTGTGCGAGG - Exonic
1151856549 17:76726222-76726244 GGTGCGGGTGAGCCTCTACGAGG + Intronic
1151987933 17:77556097-77556119 GGAGCCCCTGTGCCCCTGCCAGG + Intergenic
1152542188 17:80982002-80982024 GGAGCGTGGGAGCCCCTGCCTGG + Intergenic
1152735829 17:81996337-81996359 GGAGAGGGTGAGCCTGGGCCGGG + Intronic
1153226927 18:2906775-2906797 GGGGCGAGGGCGCCTCTGCCGGG - Exonic
1154216681 18:12420833-12420855 GGGTCGCGGGAGGCTCTGCCTGG + Intronic
1158405277 18:57154657-57154679 GGAGGGCAGGAGCCTCGGCCAGG - Intergenic
1160567684 18:79797686-79797708 TGAGCGTGTGTGCCCCTGCCAGG + Intergenic
1160872685 19:1284296-1284318 GGAGGGCGTGAACCTGTCCCAGG - Intergenic
1161072912 19:2271245-2271267 GGACCGGGTGGGCCCCTGCCTGG + Intronic
1164958437 19:32406072-32406094 GGAGCGCGGGAGTGTCTGCCGGG + Intronic
1165101162 19:33439465-33439487 GGAGTGCGTGGGCCTAGGCCAGG + Intronic
1166393683 19:42423984-42424006 GGCGCCTCTGAGCCTCTGCCTGG + Intronic
925367006 2:3317508-3317530 GGAGCGCATGAGGCGCTGACAGG + Intronic
927493113 2:23533459-23533481 AGAAAACGTGAGCCTCTGCCGGG + Intronic
927577629 2:24212668-24212690 GTAGCGGGTGATCCTCTGCATGG + Exonic
928424442 2:31166554-31166576 GGAGGGCATGAGGGTCTGCCAGG + Intergenic
934853904 2:97717403-97717425 GGAGCCTCTGAGCCTCTGGCTGG + Intronic
934853919 2:97717461-97717483 GGAGCCTCTGAGCCTCTGGCTGG + Intronic
937283813 2:120737355-120737377 GGAGCCCGTGCGCCTCACCCTGG + Intronic
948754104 2:240149286-240149308 GCAGGGCCTGAGCCTCTGCATGG + Intergenic
949043002 2:241858025-241858047 GGAGAGAGGGAGCCTCTTCCTGG - Intronic
1169392961 20:5205003-5205025 GGGGCCCGTGAGGCTCTGGCGGG - Intergenic
1171488686 20:25501475-25501497 GGGGTGTGTGCGCCTCTGCCTGG - Intronic
1172061713 20:32190975-32190997 GGAGCGAGTGGGCATCTGCCTGG + Intergenic
1175193014 20:57224084-57224106 CGAGGGCAAGAGCCTCTGCCTGG + Intronic
1177878907 21:26669264-26669286 TGAGCCCCTGAGCCTCTGGCTGG + Intergenic
1178485960 21:33020294-33020316 GGAGCCCGGGAGCCTCTCTCTGG + Intergenic
1178914451 21:36698928-36698950 GGAGCGCGCGGGTCTCTCCCGGG + Intergenic
1179973454 21:44849225-44849247 GGAGCGCGGGAGCCTCATGCAGG + Intergenic
1180225362 21:46388829-46388851 GGAGCGCGTGGGGCTCTGCCTGG + Exonic
1181256842 22:21568140-21568162 CGAGCGCCGGAGCCCCTGCCCGG + Intronic
1181372923 22:22432210-22432232 GGAGATGGTGACCCTCTGCCTGG - Intergenic
1181712019 22:24696848-24696870 GCAGCACGTGACCCCCTGCCTGG + Intergenic
1184356147 22:43980792-43980814 GGAGCAGGAGAGCCTCTACCTGG + Intronic
1185138769 22:49088834-49088856 TGAGCACGTGAGCCTGTGGCAGG + Intergenic
952764662 3:36944296-36944318 GGAGCGCGCTGGCCTCTTCCCGG - Intronic
953069539 3:39505662-39505684 GGAGTGTGACAGCCTCTGCCTGG + Intronic
963046746 3:141108159-141108181 CGAGCTCAGGAGCCTCTGCCTGG + Intronic
963607167 3:147421301-147421323 GGAGCGCCGGAGGCTCTGGCTGG + Intronic
968674731 4:1871398-1871420 CGCGCGCGAGAGCCTCGGCCTGG + Intergenic
969058613 4:4417335-4417357 GGAGCGCGTGATGCTCTGCTTGG - Exonic
969376591 4:6767483-6767505 GGTGTGGGTGAGCCTCGGCCGGG - Intergenic
971266671 4:25101981-25102003 TGAGCGTGTGAGGCTCTGACTGG - Intergenic
976770709 4:88649440-88649462 GGAGTGAGTGAAACTCTGCCTGG - Intronic
979481483 4:121223227-121223249 CAAGCGGGTGAGCATCTGCCTGG - Intronic
994759407 5:103834454-103834476 TGAGGGCCTGAGCCTATGCCTGG - Intergenic
997294455 5:132761032-132761054 GGAGGGCTTGAGCCTGGGCCAGG + Intronic
997511596 5:134458480-134458502 AGACCCCGTGAGCCTGTGCCAGG + Intergenic
997622525 5:135308011-135308033 GGAGCGCTTCACCCTGTGCCTGG + Intronic
1002595422 5:180318716-180318738 GGAGCTCCTGACACTCTGCCTGG - Intronic
1003638924 6:7860178-7860200 GGAGACCGTGACACTCTGCCTGG + Intronic
1004020444 6:11771450-11771472 AGAGCGAGAGAGCCTCTCCCAGG + Intronic
1004070277 6:12291413-12291435 GCAGTGCGTGTGCATCTGCCCGG + Intronic
1005913799 6:30334117-30334139 AGAGCTAGTCAGCCTCTGCCAGG + Intronic
1007708543 6:43806459-43806481 GGAGTGCGAGAGCCTCAGCTGGG - Intergenic
1010517407 6:76789966-76789988 GAAGCTTGAGAGCCTCTGCCTGG - Intergenic
1010784358 6:79982945-79982967 GCAGGGAGTGAGCCTCTGACAGG + Intergenic
1019486994 7:1294015-1294037 GGTGCCCGTGAGCCCGTGCCAGG - Intergenic
1022472607 7:30691060-30691082 TGACCCCGTGAGCCACTGCCAGG + Intronic
1023999970 7:45183585-45183607 GGATAGCCTGAGCCTCAGCCAGG - Exonic
1024263206 7:47587202-47587224 GCAGTGCTTGAGCCTGTGCCAGG + Intergenic
1025281652 7:57629914-57629936 GGACCGCCTGAACCTCCGCCAGG + Intergenic
1025303078 7:57835601-57835623 GGACCGCCTGAACCTCCGCCAGG - Intergenic
1031069909 7:117150606-117150628 GGAGGGCTGCAGCCTCTGCCTGG + Intronic
1036822315 8:11950826-11950848 GGAGCCCGGGAGACTCTGCCTGG + Intergenic
1038411645 8:27363674-27363696 AGAGCCCCTGAGCCTCTGCCTGG - Intronic
1041259647 8:56009837-56009859 GCAGTGCTTGACCCTCTGCCAGG + Intronic
1041641584 8:60208341-60208363 GGAGCGTGTGAGCCTCAGTGTGG - Intronic
1044806428 8:96012929-96012951 GGAGCCCGAGCACCTCTGCCTGG + Intergenic
1047081957 8:121472271-121472293 GGAGCTCCTCGGCCTCTGCCTGG - Intergenic
1047227744 8:122970807-122970829 GGAGTGCATGTGGCTCTGCCTGG + Intronic
1048963632 8:139599660-139599682 GAAGGGCCTCAGCCTCTGCCAGG - Intergenic
1049169530 8:141150771-141150793 AGTGCACGTCAGCCTCTGCCCGG + Intronic
1053416569 9:37950555-37950577 GGAGGGGGTGAGACTCAGCCAGG + Intronic
1055513312 9:77015669-77015691 GGAGCGCGTGAGACCCTCCAGGG + Intergenic
1056527318 9:87455397-87455419 GAAGCTTGGGAGCCTCTGCCTGG - Intergenic
1056601826 9:88052810-88052832 GTGGCCAGTGAGCCTCTGCCTGG - Intergenic
1057186907 9:93062169-93062191 GCCGCGCCTGCGCCTCTGCCTGG - Intronic
1057562726 9:96140736-96140758 GGGGCCCGTGAGCCTCCTCCTGG - Intergenic
1059345661 9:113626078-113626100 GGAGGGCCTCAGCCTCTGGCTGG + Intergenic
1061484532 9:130913736-130913758 GGAGTGCCTGAGCTTCTGCTAGG - Intronic
1061577515 9:131516720-131516742 GGTGCGCTTGAGGCTCTGCCAGG + Intronic
1061582553 9:131546493-131546515 GGAGTGCGCGAGACTCTGCAGGG - Intergenic
1061825408 9:133255654-133255676 GGAACCCGTGAGCGGCTGCCAGG - Exonic
1061878892 9:133558609-133558631 GGAGCCCGTGAGCCTGTGTCTGG + Intronic
1061931717 9:133836260-133836282 GGAGCCAGGGAGGCTCTGCCAGG + Intronic
1062420257 9:136477281-136477303 GGACCCTGTGAGCCCCTGCCTGG - Exonic