ID: 1142176631

View in Genome Browser
Species Human (GRCh38)
Location 16:88648231-88648253
Sequence CACAGCACAGTGACAGGGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 303}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142176619_1142176631 -8 Left 1142176619 16:88648216-88648238 CCCCCTACCCATCCCCACAGCAC 0: 1
1: 0
2: 9
3: 82
4: 703
Right 1142176631 16:88648231-88648253 CACAGCACAGTGACAGGGTCGGG 0: 1
1: 0
2: 1
3: 35
4: 303
1142176621_1142176631 -10 Left 1142176621 16:88648218-88648240 CCCTACCCATCCCCACAGCACAG 0: 1
1: 0
2: 3
3: 29
4: 479
Right 1142176631 16:88648231-88648253 CACAGCACAGTGACAGGGTCGGG 0: 1
1: 0
2: 1
3: 35
4: 303
1142176614_1142176631 13 Left 1142176614 16:88648195-88648217 CCACCAGGCCACCCAGAGCTGCC 0: 1
1: 1
2: 4
3: 55
4: 515
Right 1142176631 16:88648231-88648253 CACAGCACAGTGACAGGGTCGGG 0: 1
1: 0
2: 1
3: 35
4: 303
1142176617_1142176631 2 Left 1142176617 16:88648206-88648228 CCCAGAGCTGCCCCCTACCCATC 0: 1
1: 0
2: 2
3: 40
4: 308
Right 1142176631 16:88648231-88648253 CACAGCACAGTGACAGGGTCGGG 0: 1
1: 0
2: 1
3: 35
4: 303
1142176616_1142176631 5 Left 1142176616 16:88648203-88648225 CCACCCAGAGCTGCCCCCTACCC 0: 1
1: 0
2: 3
3: 57
4: 547
Right 1142176631 16:88648231-88648253 CACAGCACAGTGACAGGGTCGGG 0: 1
1: 0
2: 1
3: 35
4: 303
1142176618_1142176631 1 Left 1142176618 16:88648207-88648229 CCAGAGCTGCCCCCTACCCATCC 0: 1
1: 1
2: 3
3: 45
4: 404
Right 1142176631 16:88648231-88648253 CACAGCACAGTGACAGGGTCGGG 0: 1
1: 0
2: 1
3: 35
4: 303
1142176615_1142176631 10 Left 1142176615 16:88648198-88648220 CCAGGCCACCCAGAGCTGCCCCC 0: 1
1: 0
2: 6
3: 81
4: 542
Right 1142176631 16:88648231-88648253 CACAGCACAGTGACAGGGTCGGG 0: 1
1: 0
2: 1
3: 35
4: 303
1142176613_1142176631 24 Left 1142176613 16:88648184-88648206 CCTACTGTGGGCCACCAGGCCAC 0: 1
1: 0
2: 4
3: 16
4: 188
Right 1142176631 16:88648231-88648253 CACAGCACAGTGACAGGGTCGGG 0: 1
1: 0
2: 1
3: 35
4: 303
1142176620_1142176631 -9 Left 1142176620 16:88648217-88648239 CCCCTACCCATCCCCACAGCACA 0: 1
1: 0
2: 1
3: 40
4: 559
Right 1142176631 16:88648231-88648253 CACAGCACAGTGACAGGGTCGGG 0: 1
1: 0
2: 1
3: 35
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142176631 Original CRISPR CACAGCACAGTGACAGGGTC GGG Intronic
900015478 1:146059-146081 CACAGCACAGTTACAGAGGAAGG + Intergenic
900265982 1:1757465-1757487 CGCGCCACAGAGACAGGGTCAGG + Intronic
901392403 1:8955393-8955415 AAAAGCACAGTAACAGGCTCAGG + Intronic
901794522 1:11672734-11672756 CACAGAACTGTGCCAGGCTCTGG + Intronic
903889361 1:26559136-26559158 CCCAGCACAGAGCCAGGGTCTGG + Intronic
904286236 1:29454774-29454796 GGGAGCACACTGACAGGGTCTGG + Intergenic
904360652 1:29969550-29969572 CACAGCAAAGAGACAAGCTCAGG - Intergenic
904416911 1:30368596-30368618 CTCTGCACTGTGACAGGTTCTGG - Intergenic
905357490 1:37394909-37394931 CACACCACAGGGGCGGGGTCTGG + Intergenic
905609132 1:39333716-39333738 CAGAGCACAGTGTCTGGGTACGG - Intronic
906537683 1:46560708-46560730 TAGAGCACAGAGACAGGGACTGG + Intronic
907507242 1:54928600-54928622 CCCAGCACAGTGACTGGCACAGG + Intergenic
908001313 1:59683143-59683165 CTTAGCACAGTGCCAGGCTCAGG - Intronic
908270341 1:62415831-62415853 CGCAGCACATTGAAAGGTTCAGG - Intergenic
908700806 1:66897998-66898020 CCCAGCAAAGTCACAGGGTCAGG + Intronic
911144087 1:94535711-94535733 CTGAGGACAGTAACAGGGTCTGG + Intronic
911588488 1:99718577-99718599 CCCAGCACTGTGGGAGGGTCTGG - Intronic
912255360 1:108052805-108052827 TACAGGAAAGTGACAGGATCTGG + Intergenic
914376076 1:147075070-147075092 CCCAGCACAGTGAGAGGCTGAGG + Intergenic
915118739 1:153615697-153615719 CACATCTCACTCACAGGGTCTGG + Intronic
916559252 1:165918745-165918767 CACAGGACAGGCACAGAGTCGGG + Intergenic
916787794 1:168098777-168098799 CACTGCACAGTGGCTGGGTAAGG + Intronic
918144079 1:181740600-181740622 CACAGTCCAGTTCCAGGGTCTGG - Intronic
919922681 1:202175781-202175803 CAGACAACAGTGACAGGGGCAGG - Intergenic
920671107 1:208004226-208004248 GACAGCACAGTGAGAGGCTAAGG + Intergenic
922425345 1:225487046-225487068 TCCACCACAGTGACAGGGCCAGG + Exonic
924537769 1:244952113-244952135 CCCAGCACATTGACAGGCTGAGG + Intergenic
1063126757 10:3142685-3142707 CACAGCCAAGAGTCAGGGTCAGG - Intronic
1063231589 10:4070845-4070867 CTCAGCACAGACACAGGGGCTGG + Intergenic
1065535632 10:26712485-26712507 CACAGTGCAGAGACAGCGTCCGG + Intronic
1065949648 10:30640569-30640591 CACAGCTGAGTGTCAGGGGCTGG + Intergenic
1066517868 10:36184079-36184101 CACAGGACAGTGAAAAGGCCTGG - Intergenic
1067563242 10:47318804-47318826 GACAGCACAGGGAGAGAGTCAGG - Intergenic
1068665694 10:59673301-59673323 CAGGGCACAGTAACACGGTCAGG - Intronic
1068681216 10:59822705-59822727 GGCAACACAGTGACAGGGACAGG + Intronic
1069842433 10:71348182-71348204 CCCAGCACAGGCACAGGGCCTGG - Intronic
1070417745 10:76206210-76206232 CTGAGAACAGTGAGAGGGTCAGG - Intronic
1071948207 10:90672083-90672105 CACAGCACAGTAAAATGGTGGGG - Intergenic
1072626512 10:97115754-97115776 CACAGTACAGTGAGAAGGCCGGG - Intronic
1072923809 10:99598657-99598679 TACAACACAGTGCCAGGGGCAGG - Intergenic
1074675011 10:115838379-115838401 CACAGCACACTGACAGCAACAGG + Intronic
1075098218 10:119487653-119487675 GACAGCACAGTGAGAGGCCCAGG + Intergenic
1075499432 10:122959040-122959062 CACAGCCCAGTGGCAGGGGCTGG - Intronic
1075593212 10:123707676-123707698 CACAGCAGAGTCTCAGGTTCTGG + Intronic
1076301638 10:129432995-129433017 GACAGCACAGTGGCAGGCACCGG + Intergenic
1076435702 10:130439916-130439938 CACCACACAGTGACAGGCACGGG - Intergenic
1076669394 10:132111363-132111385 CACAGCAAGGTCCCAGGGTCGGG + Intronic
1077269700 11:1669944-1669966 CGAAGCACAGAGCCAGGGTCTGG + Intergenic
1080950545 11:37027476-37027498 CACTACACAGTGGCAGTGTCTGG + Intergenic
1083888123 11:65582544-65582566 GACAGCACAGTGTGAGGGACTGG + Exonic
1086416063 11:86589924-86589946 CACATCACAGTGATGGGGTGTGG + Intronic
1087136825 11:94729600-94729622 CACAGCTCTGTGTCAGGGTATGG - Intronic
1089601012 11:119615130-119615152 ATCAGCACAGTGCCAGGGCCAGG - Intergenic
1090647674 11:128778761-128778783 CACAGGCCTGTGGCAGGGTCAGG + Intronic
1090834548 11:130444700-130444722 CCCAGCACTGTGTCAGGCTCTGG + Intergenic
1093705897 12:22274860-22274882 GGCAGCACATAGACAGGGTCTGG - Intronic
1095966431 12:47870277-47870299 CAAAGCACAGAGCCAGGGTTGGG - Intronic
1100739562 12:97576455-97576477 CACTAACCAGTGACAGGGTCAGG - Intergenic
1101561677 12:105863137-105863159 CCCAGCACAGTGCCTGGGTCTGG - Intergenic
1101832705 12:108271788-108271810 AGCAGGAAAGTGACAGGGTCAGG + Intergenic
1102012893 12:109629635-109629657 CCCAGCACCGGCACAGGGTCTGG + Intergenic
1103914708 12:124370248-124370270 CTCATCACAGGGTCAGGGTCAGG + Intronic
1104947651 12:132423732-132423754 CACAGCACAGTGGCAGAGCTGGG - Intergenic
1105481543 13:20782302-20782324 CACAGCACAGTGACAGGTAGAGG - Exonic
1109387211 13:61646607-61646629 AACAGAAGAGTGACATGGTCTGG + Intergenic
1111955191 13:94749608-94749630 TATAGCACAGTGACAGTGACAGG + Intergenic
1112975914 13:105316897-105316919 CACGTCACAGTGACAGCTTCAGG - Intergenic
1113906438 13:113821501-113821523 CACAGCACAGAGGCTGGGACCGG - Intronic
1115412387 14:33090112-33090134 AACATCACAATGACAGGATCAGG + Intronic
1115753273 14:36510810-36510832 CAGAGCACAGGGACAGGGGAAGG + Intronic
1116425892 14:44790805-44790827 CACAGCTAAGTGACAGAGCCAGG - Intergenic
1117346186 14:54835210-54835232 CACAGCACAGGGCCAGGGTGGGG + Intergenic
1118319621 14:64745552-64745574 CACTGGACAGTGTGAGGGTCAGG - Exonic
1118396152 14:65338480-65338502 AACAGCACAGGCATAGGGTCTGG + Intergenic
1119391561 14:74294603-74294625 CAGAGCACAGGGACCGGTTCTGG + Intronic
1119668438 14:76500560-76500582 CACAGCACAGTGAGAGACTGAGG - Intronic
1120655283 14:87181854-87181876 CAAAGCATAGAGACAGGGTTAGG - Intergenic
1121417787 14:93790849-93790871 CACTGAACAGTGACAGAATCGGG - Intergenic
1121867551 14:97377116-97377138 CACAGCACTCTGTCTGGGTCTGG - Intergenic
1122837435 14:104437032-104437054 CACAGCACGGGGGCAGGGTGAGG + Intergenic
1122853691 14:104549638-104549660 CACAGCACGCAGACTGGGTCAGG + Intronic
1123438082 15:20270225-20270247 CCCAGCACAGTGCCAGGCACAGG + Intergenic
1123947439 15:25245668-25245690 AAGAGCACAGAGACAGGGTTGGG - Intergenic
1124354431 15:28984491-28984513 CACAGCAGAGAGACTGAGTCAGG - Intronic
1124424270 15:29550048-29550070 CTCAGCAGAGGGACAGTGTCTGG - Intronic
1127391146 15:58506063-58506085 CACACCACAGAGACAGAGTGGGG - Intronic
1128188605 15:65667648-65667670 TACGGAACAGTGACAGGATCGGG + Exonic
1128641773 15:69343871-69343893 CACAGCACAGTGGAAGATTCAGG + Intronic
1128704196 15:69826855-69826877 CCCAGCACAGAGTCAGGGGCTGG + Intergenic
1130063028 15:80583099-80583121 CACAGTCCAGAGACTGGGTCAGG + Intronic
1130297523 15:82657637-82657659 CACAGCACTGAGAGAGGGTGAGG - Intergenic
1130652423 15:85769622-85769644 CACGGCACGGTGACAGGGGAAGG + Exonic
1132342714 15:101088365-101088387 CCCAGCACAGGGACAGGAACAGG + Intergenic
1133854090 16:9533547-9533569 CTCAGCACAGCGAGGGGGTCTGG - Intergenic
1133974431 16:10590522-10590544 CCCAGCACTGGGACAGAGTCTGG - Intergenic
1134402260 16:13920689-13920711 CCCCGCACAGTGTCAGGGACTGG - Intronic
1134410427 16:13999414-13999436 CACACCAAAGTGACTGGCTCTGG + Intergenic
1134490326 16:14691364-14691386 CACAGGGCAGTGCCAGGGCCCGG - Intronic
1134495707 16:14730481-14730503 CACAGGGCAGTGCCAGGGCCCGG - Intronic
1134501254 16:14770792-14770814 CACAGGGCAGTGCCAGGGCCTGG - Intronic
1134579326 16:15358242-15358264 CACAGGGCAGTGCCAGGGCCTGG + Intergenic
1134640901 16:15828494-15828516 CCCCGCACAGTGCCAGGGACAGG + Intronic
1134723256 16:16399312-16399334 CACAGGGCAGTGCCAGGGCCTGG - Intergenic
1134944172 16:18312558-18312580 CACAGGGCAGTGCCAGGGCCTGG + Intergenic
1135251829 16:20906895-20906917 CAAAGTGCAGTGAGAGGGTCTGG - Intronic
1136041230 16:27580466-27580488 CACAGGCCAGTGAGAGAGTCTGG + Intronic
1136165596 16:28450900-28450922 CACAGGGCAGTGCCAGGGCCCGG + Intergenic
1136197376 16:28664109-28664131 CACAGGGCAGTGCCAGGGCCCGG - Intergenic
1136213715 16:28778256-28778278 CACAGGGCAGTGCCAGGGCCCGG - Intergenic
1136258449 16:29058180-29058202 CACAGGGCAGTGCCAGGGCCCGG - Intergenic
1136320046 16:29478136-29478158 CACAGGGCAGTGCCAGGGCCCGG + Intergenic
1136434617 16:30217477-30217499 CACAGGGCAGTGCCAGGGCCCGG + Intergenic
1136712630 16:32252889-32252911 AGCAGCACAGTGACAGCGTCTGG + Exonic
1136723103 16:32339524-32339546 GCCAGGACAGGGACAGGGTCAGG + Intergenic
1136755285 16:32676540-32676562 AGCAGCACAGTGACAGCGTCTGG - Exonic
1136812828 16:33193829-33193851 AGCAGCACAGTGACAGCGTCTGG + Exonic
1136819304 16:33303909-33303931 AGCAGCACAGTGACAGCGTCTGG + Intronic
1136825867 16:33360444-33360466 AGCAGCACAGTGACAGCGTCTGG + Exonic
1136830933 16:33459215-33459237 AGCAGCACAGTGACAGCGTCTGG + Intergenic
1136846496 16:33580627-33580649 CCCAGCACAGTGCCAGGCACAGG - Intergenic
1138121742 16:54405782-54405804 CTCAGCACAGTGACTTGGACAGG + Intergenic
1138619317 16:58198411-58198433 CCAAGGACAGTGAAAGGGTCGGG - Intergenic
1139965331 16:70742128-70742150 CACAGCCTTGTGACAGGGCCAGG - Intronic
1140046766 16:71444777-71444799 CACAGGACTGTGAAAGGGTGGGG - Intergenic
1140736093 16:77899065-77899087 CTCAGCACAGTGCCTGGCTCTGG - Intronic
1141195624 16:81858684-81858706 CAAAGGACAGATACAGGGTCTGG + Intronic
1142176631 16:88648231-88648253 CACAGCACAGTGACAGGGTCGGG + Intronic
1202991405 16_KI270728v1_random:16799-16821 AGCAGCACAGTGACAGCGTCTGG + Intergenic
1203003328 16_KI270728v1_random:178240-178262 GCCAGGACAGGGACAGGGTCAGG - Intergenic
1203057428 16_KI270728v1_random:936879-936901 AGCAGCACAGTGACAGCGTCTGG - Intergenic
1203108204 16_KI270728v1_random:1429281-1429303 CCCAGCACAGTGCCAGGCACAGG - Intergenic
1203134936 16_KI270728v1_random:1714647-1714669 GCCAGGACAGGGACAGGGTCAGG - Intergenic
1142826520 17:2515461-2515483 CAAAGGACAGTGACAGGGAAGGG - Intergenic
1144794358 17:17881095-17881117 CTCAGCACAGAGACAGGGACAGG + Intronic
1148610483 17:48961450-48961472 CACAGCACAGTCACTGAGTCAGG - Intronic
1148741046 17:49892879-49892901 CACAGCACAGGGAAGGGGGCAGG + Intergenic
1149291697 17:55224102-55224124 CCCAGCACTTTGACAGGCTCAGG + Intergenic
1150338631 17:64348063-64348085 TACAGCTCAGAGACAGGGCCAGG + Intronic
1152263267 17:79278555-79278577 CACAGCACACAGGCAGGGTGGGG - Intronic
1154129859 18:11727326-11727348 GACGGCCCAGGGACAGGGTCTGG - Intronic
1154269418 18:12906620-12906642 CACCGCACTGTGGCAGGGTGTGG - Intronic
1155811033 18:30235553-30235575 CAAAGCACAGTGAAAGAGGCAGG - Intergenic
1157202265 18:45669119-45669141 CCCTGCACAGTGACAGGGTGGGG - Intronic
1157523933 18:48364312-48364334 CACAGCAGAGGGACAGGCTGCGG + Intronic
1157559445 18:48636353-48636375 CCCAGCACAGTGACAAAGACTGG - Intronic
1159151893 18:64532722-64532744 CAAAGCCCAGTGACATGGTTTGG + Intergenic
1159924524 18:74255630-74255652 GACAGCACAGTGTCAGGCCCAGG + Intronic
1160226160 18:77012713-77012735 CACAGCACACTGACGTGGTGGGG + Intronic
1160393636 18:78556539-78556561 CACAGCACAGTGAACAGATCGGG - Intergenic
1160840779 19:1146257-1146279 CCCAGCACAGACTCAGGGTCCGG + Intronic
1161217193 19:3100426-3100448 CACAGCTCAATGACATGGGCAGG - Intronic
1163374335 19:16921205-16921227 CACTGCACAGTCACAGTGCCAGG - Intronic
1164754090 19:30677414-30677436 GGCAGCACAGTGACAAGGACAGG + Intronic
1164873693 19:31668105-31668127 CACAAGAGAGTGTCAGGGTCAGG + Intergenic
1165034051 19:33020126-33020148 CCCAGCACAGTGCCAGGCACAGG + Intronic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1165129044 19:33621171-33621193 CACAGCACCGGGACAGAGTAGGG - Intergenic
1165392090 19:35544714-35544736 CAAGGCACTGTGTCAGGGTCTGG - Intronic
1165601389 19:37058006-37058028 CACAGCACAGTGTCACCGACAGG - Intronic
1165655164 19:37526510-37526532 CAGGGCACAGTGACAGGCTCTGG - Intronic
1168026220 19:53645539-53645561 CAAGGCACAGTGTCAGTGTCTGG + Intergenic
925314733 2:2912745-2912767 CACAGCACAGTGCGATGTTCTGG - Intergenic
926459862 2:13115628-13115650 CACAGCACGATGAAAGGCTCAGG - Intergenic
927418098 2:22900954-22900976 CACAGCACAGATAGATGGTCTGG - Intergenic
928181466 2:29071530-29071552 CACAGCACAGGGCCAGGGAGTGG - Exonic
931400097 2:61924130-61924152 CACTGCAGAGTGACATGGTTTGG - Intronic
932626093 2:73297159-73297181 CACAGCCCAGTGCCAGGTGCTGG + Intergenic
934770305 2:96903520-96903542 CACCTCTCAGTGACTGGGTCAGG - Intronic
936029246 2:109058387-109058409 CACGGCGCTGTGACAGGGCCTGG - Intergenic
936031307 2:109072927-109072949 CACAGCCCAGTCAGAGAGTCTGG - Intergenic
936348097 2:111690575-111690597 CATAGCCCAGTGACAGAGCCTGG + Intergenic
937175928 2:119935135-119935157 AACAACATAGTGACTGGGTCGGG - Intronic
938068471 2:128294219-128294241 CAGAGCACAGTGCCAGGGCCGGG - Intronic
938214500 2:129499613-129499635 CAGAGCACAGGGAGAGGGTGTGG + Intergenic
942474358 2:176301380-176301402 CTCAGCACAGTGACAAGCACAGG - Intronic
946361585 2:219222272-219222294 CACAGCACCATGACAGGCTCTGG - Exonic
948469912 2:238170715-238170737 CTCAGGAAAGTGACAGGGTGCGG - Intronic
1169117445 20:3074910-3074932 CACTGCCCAGTGACATGGGCAGG - Intergenic
1170533210 20:17315204-17315226 CACACCACACTGAGAGAGTCAGG - Intronic
1172595511 20:36148631-36148653 CAGAGCACAGTAAGAGGATCTGG - Intronic
1172965465 20:38831262-38831284 CACAGCCCAATGCCAGGATCTGG - Intronic
1173582044 20:44154127-44154149 AACTGCTCAGTGACAGGGTTGGG + Intronic
1174720983 20:52812314-52812336 CACAGCTCGGTGACATTGTCAGG + Intergenic
1175456260 20:59117272-59117294 CACAGCAATGACACAGGGTCAGG - Intergenic
1175661518 20:60816975-60816997 TTCCACACAGTGACAGGGTCTGG - Intergenic
1175763748 20:61578997-61579019 CTCAGCACACGGTCAGGGTCGGG - Intronic
1178156384 21:29858718-29858740 CTCTGCTCAGTGACAGAGTCTGG + Intronic
1178348702 21:31854356-31854378 CACAGCAGGGTGACTGGGTTTGG + Intergenic
1178783015 21:35624004-35624026 AACAGGACAGAGATAGGGTCTGG - Intronic
1181032908 22:20156914-20156936 CACAGGGCAGTGACGGGGACGGG - Intergenic
1181474627 22:23160687-23160709 GGCAGCACAGTGCCAGGGGCAGG - Intronic
1181550512 22:23636607-23636629 CACAGCACATGGACAGGTCCCGG - Intergenic
1181797767 22:25322085-25322107 CACAGCACATGGACAGGTCCCGG + Intergenic
1182792029 22:32960889-32960911 CTCAGGATAGGGACAGGGTCAGG - Intronic
1183521430 22:38298117-38298139 CCCAGCACAGGGACAGGGGCGGG + Intronic
1184224319 22:43120505-43120527 AACAGAGCAGTGACAGGGTCAGG + Intronic
1185169066 22:49281778-49281800 CAGAGGACAGTGACTGGGCCAGG + Intergenic
949544382 3:5060075-5060097 CACAGCAAAGTGCCATGGACTGG - Intergenic
949706511 3:6824222-6824244 CACAGCCCTGTGCCAGGCTCAGG - Intronic
950097722 3:10339522-10339544 CTCAGAGCTGTGACAGGGTCTGG + Intronic
950434892 3:12973506-12973528 CACAGGACAATGGCAGTGTCTGG - Intronic
950855672 3:16102412-16102434 CACAGCACAGTGGCAGAGCAGGG + Intergenic
950868836 3:16211894-16211916 CACAGCAAACTCATAGGGTCTGG - Intronic
951432869 3:22628294-22628316 CACAGCACAGAGACTGTGACAGG - Intergenic
951846189 3:27087200-27087222 CAAAGCACAGTCACAGGGACTGG + Intergenic
954681987 3:52350810-52350832 GACAGGACAGAGACAGGGTTGGG - Intronic
956522543 3:70121760-70121782 GACAGGACAGTGACAGGGCAGGG + Intergenic
960165920 3:114401134-114401156 CACAGCACAGTGAGACAGACAGG + Intronic
961054625 3:123777724-123777746 CACAGAACAATGACAGAGCCAGG + Intronic
961414782 3:126749322-126749344 CAAAGGACAGTGACAGTATCTGG + Intronic
961685472 3:128627001-128627023 CACAACACAGAGACAGGGATGGG + Intronic
962344457 3:134609222-134609244 CACAGCACAGAAACAGGTTGGGG - Intronic
966113540 3:176432832-176432854 CACAGCACAGAGAAAGGGAGGGG - Intergenic
967877220 3:194275690-194275712 CACAGCAGAGTGGCAGGGGTGGG + Intergenic
968047103 3:195630652-195630674 CTCTGCACAGTTCCAGGGTCAGG + Intergenic
968307545 3:197659392-197659414 CTCTGCACAGTTCCAGGGTCAGG - Intergenic
968368822 3:198208692-198208714 CACAGCACAGTTACAGAGGAAGG - Intergenic
968582266 4:1400624-1400646 CAAAGCACAGTGGGAGGCTCAGG + Intergenic
969056818 4:4407483-4407505 CTCAGCACAGTGCCCGGGGCAGG - Intronic
969874925 4:10129220-10129242 CACAGCACAATGATATAGTCTGG + Intergenic
969877753 4:10148567-10148589 CACAGCACTATGGCAGTGTCTGG - Intergenic
972685287 4:41346745-41346767 CACAGCACAGGCCCAGGGCCTGG + Intergenic
975825842 4:78318843-78318865 CCCAGTACAGTGAGAGGGTGCGG - Exonic
978648972 4:110976963-110976985 CACAGCACAGTCCCAAGCTCAGG + Intergenic
978802539 4:112769339-112769361 CCCAGCACAGAGTCAGAGTCGGG + Intergenic
978955555 4:114608232-114608254 CACAGAAAAGTGACAGAGACTGG - Intronic
979192269 4:117876417-117876439 CAGAGCACAGGGGCAGGGGCTGG - Intergenic
981585872 4:146301562-146301584 CACAGCAGAGAGACAGGTTTAGG + Intronic
982120554 4:152139008-152139030 CACAGCACAGGCACAGAGACAGG + Intergenic
983908058 4:173205656-173205678 CCCAGCCCAGTGACAGGGGATGG - Intronic
984868625 4:184307784-184307806 CACAACACAGGGTCAGGGTCAGG + Intergenic
984876972 4:184377835-184377857 CACAGCACAGTTAAAGGGAAGGG - Intergenic
985424308 4:189813359-189813381 CCCAGCACAGTGGCAGAGCCTGG + Intergenic
985535894 5:465567-465589 GAAAGCTCAGTGACAGGGCCAGG - Intronic
985855933 5:2427063-2427085 AACAGCACAGTTACAGAGGCAGG - Intergenic
985881027 5:2639277-2639299 CACGGCTCAGTGACCGGCTCCGG + Intergenic
987125788 5:14811279-14811301 CACAGCACAGCGACAGGGAAGGG + Intronic
988494597 5:31734292-31734314 AACAACAAAATGACAGGGTCTGG - Intronic
989109534 5:37893930-37893952 CACAGCACAGGGACAGTCACAGG - Intergenic
989308678 5:39987592-39987614 AACAGCACAGTGGCAGGTGCAGG - Intergenic
990031073 5:51260162-51260184 CACACAACAGTGAAAGGATCAGG - Intergenic
991210261 5:64096293-64096315 GACAACACAGTCACAGGTTCTGG + Intergenic
992103755 5:73432915-73432937 CACAGGACAGGGAAAGGGTGGGG - Intergenic
992551506 5:77864913-77864935 CACAAGAAGGTGACAGGGTCAGG + Intronic
994680905 5:102886583-102886605 CAGATCACTGTGAGAGGGTCAGG - Intronic
994738945 5:103594395-103594417 CAGAGCACAGTGAAAGAGTTTGG - Intergenic
995623178 5:114050289-114050311 CACAGCACAGTGTCTGGCCCTGG - Intergenic
995981815 5:118113440-118113462 GACAGGACAGGGACAGGGACAGG - Intergenic
998797969 5:145838911-145838933 AAAAGCAGAGAGACAGGGTCAGG - Intergenic
999713725 5:154342041-154342063 TACTGCACCGTGACAGGGCCGGG + Intronic
1000284425 5:159814946-159814968 CAGAGAACAATCACAGGGTCAGG + Intergenic
1000792807 5:165627808-165627830 CATAACACAGTCACAGGTTCTGG + Intergenic
1002691672 5:181054298-181054320 CACTGCACAGGCACAGGGTCCGG - Intronic
1005363041 6:25050344-25050366 CACAGTACCGTGACAGCTTCTGG - Intergenic
1006151796 6:31993843-31993865 CACAGCACAGAGAAAAGGCCGGG - Intronic
1006158097 6:32026581-32026603 CACAGCACAGAGAAAAGGCCGGG - Intronic
1007202376 6:40120866-40120888 CAGAGCCCAGGGACAGGGTGGGG + Intergenic
1009404562 6:63295920-63295942 GAGAGGAAAGTGACAGGGTCAGG + Intronic
1009840573 6:69068194-69068216 CACAGCACAGTCATAGATTCTGG - Intronic
1011117129 6:83905998-83906020 CACAGCACAGTTTGAGGGCCAGG - Intronic
1011363868 6:86558656-86558678 GACAGCACAGAGACAGTGTGAGG - Intergenic
1011781110 6:90790376-90790398 CACAGCCCAGGGCCAAGGTCAGG + Intergenic
1014779331 6:125545060-125545082 CACAGCAAAGTCACATGGACTGG + Intergenic
1015812490 6:137174925-137174947 CAGAGAACAGTGACAGAGGCAGG - Intergenic
1017147550 6:151248378-151248400 CCCAGCACAGTGGCAGGAGCTGG - Intronic
1017252407 6:152295343-152295365 CTCAAGACAGTGACAGGGTTAGG - Intronic
1017811723 6:157988529-157988551 CACAGCAGAGAGACACGGGCTGG - Intronic
1018526102 6:164711010-164711032 CACATCACAGTGATACGGACAGG - Intergenic
1018577074 6:165270303-165270325 CACAGCGCAGTGACAGGAGAGGG + Intergenic
1018601817 6:165552254-165552276 CATAGCACAGTGCCTGGCTCTGG + Intronic
1018763798 6:166913371-166913393 CACAACACACTGACAGAGGCTGG + Intronic
1019075764 6:169387093-169387115 CACAGAACAGAGACAGGCACAGG + Intergenic
1019407023 7:889231-889253 CACAGCACCGTCACGGTGTCGGG - Intronic
1019615604 7:1958453-1958475 CACCGCACAGGGACAGGAGCAGG + Intronic
1019740733 7:2671641-2671663 CTCAGCACAGTGACATCATCAGG + Intergenic
1022214084 7:28240791-28240813 CACAGCAGAGTGAGAGGGACAGG - Intergenic
1023877611 7:44295906-44295928 CACAGCACAGGGGCAGGCACAGG + Intronic
1023994845 7:45153007-45153029 TACAGCACAGTGACAGAGGGAGG - Intergenic
1024063111 7:45713565-45713587 CACATCCCAGTGCCAGGGTTGGG + Intronic
1026461200 7:70616587-70616609 CAGAGCACAGTGTCAGGCACTGG - Intronic
1026930393 7:74220263-74220285 CACAGGGCAGGGACAGGGACAGG + Intronic
1027263283 7:76479953-76479975 CACAGCAAAGAGACAGGATCAGG + Intronic
1027314663 7:76978058-76978080 CACAGCAAAGAGACAGGATCAGG + Intergenic
1027377019 7:77561497-77561519 CACAGCACTGTGGCAGTCTCCGG + Intronic
1028183812 7:87756916-87756938 CAAAGCTCAGTGTCATGGTCTGG - Intronic
1030320528 7:108163399-108163421 CACAGAAGAGAGACAGGGTGAGG + Intronic
1032076325 7:128837847-128837869 CACAGCACAGTGTGTGGCTCTGG - Intronic
1033567394 7:142592697-142592719 CACGGGACAGAGACAGGGACAGG + Intergenic
1033604823 7:142919204-142919226 CCCAGCACACTGAAAGTGTCTGG + Intronic
1034072752 7:148202797-148202819 CCCAGCACAGTGAGAGCCTCTGG - Intronic
1034838480 7:154374083-154374105 CACAGCAACGTGACAGGGTTAGG - Intronic
1034950095 7:155291167-155291189 CTCAGCACAATGACAGGTTTGGG - Intergenic
1035248019 7:157577730-157577752 CACACCACACTCCCAGGGTCTGG + Intronic
1035339419 7:158151020-158151042 GGCAGGACAGTGACAGGGCCTGG - Intronic
1037397109 8:18454651-18454673 CACAGTACAGTGCTAGGGCCAGG - Intergenic
1038614549 8:29080552-29080574 CACATCACCCTGTCAGGGTCTGG - Intronic
1038988782 8:32843308-32843330 CACAGTTCAGTGACAAGGTATGG + Intergenic
1040415060 8:47188574-47188596 CACGGCACAGTCCCTGGGTCCGG + Intergenic
1041131853 8:54710048-54710070 CACAGCCCACTGCCAGGGTTAGG - Intergenic
1041552885 8:59119913-59119935 GGGAGCACAGTGACAGGGTTGGG - Intergenic
1043750217 8:83925731-83925753 CACAGCACAGAGCCAGGCACTGG + Intergenic
1044107999 8:88236182-88236204 AACAGCACAGTTACAGGGCAGGG + Intronic
1044894126 8:96870697-96870719 CACAGCACACTGGCAGGCACAGG + Intronic
1045501971 8:102750272-102750294 GAGAGCACAGAGACAGGGCCAGG - Intergenic
1045640172 8:104241074-104241096 CAGAGCACAGTGAAGGAGTCAGG - Intronic
1045702678 8:104884920-104884942 CACATCTAAGTGGCAGGGTCAGG - Intronic
1048213195 8:132474159-132474181 CTCAGGACAGTCACAGTGTCAGG + Intronic
1049534208 8:143170557-143170579 CACAGCAGAGTGACGGGATGTGG + Intergenic
1053174101 9:35909919-35909941 CCCAGCACAGGGCCAGGGGCTGG + Intergenic
1054755160 9:68950319-68950341 AACAGCAGAGTGAAATGGTCAGG - Intronic
1056205724 9:84317526-84317548 TACAGCACAGTGCCAGGGAGAGG - Intronic
1056561687 9:87735356-87735378 CACAGCCCAGGGACATGGTTAGG + Intergenic
1056567731 9:87789645-87789667 CAGAGCACAGGGACAGGGCCGGG + Intergenic
1056687522 9:88778653-88778675 CACAGCCCAGGGACAGAGTGAGG - Intergenic
1057704288 9:97386647-97386669 AACAGCAGGGTGACAGGGCCCGG + Intergenic
1057873639 9:98736425-98736447 CACAGCAGTGTGACGGGGGCAGG + Exonic
1057909822 9:99010274-99010296 CCCAGAACAGTGACAGAATCAGG - Intronic
1059926397 9:119213791-119213813 CACTCCAAAGTGAAAGGGTCAGG + Intronic
1060315781 9:122509180-122509202 CACAGCAGATTTACAGGTTCTGG + Intergenic
1061159083 9:128882825-128882847 CACAGGACTGGGACAGGGTCTGG - Exonic
1061374433 9:130215678-130215700 CTCAGCACAGTGCCTGGGTTTGG + Intronic
1061775305 9:132959098-132959120 CCCAGGACAGTGACATGGTTTGG + Intronic
1061999680 9:134209691-134209713 CTCAGCTCAGGGACAGGGACAGG - Intergenic
1062181535 9:135193691-135193713 CCCACCACAGTGACAGGGACTGG + Intergenic
1062262867 9:135671568-135671590 CACAGCGCAGTGCCAGGGCCAGG + Intergenic
1062577787 9:137216637-137216659 CACAGCTCACTGTCAGGGTGGGG - Exonic
1062639995 9:137514230-137514252 CACAGCCCAGCCACAGGGCCCGG - Intronic
1062640148 9:137514709-137514731 CACAGCCCAGCCACAGGGCCCGG - Intronic
1062640206 9:137514905-137514927 CACAGCCCAGCCACAGGGCCCGG - Intronic
1062753163 9:138271398-138271420 CACAGCACAGTTACAGAGGAAGG - Intergenic
1186756297 X:12674900-12674922 CACAGAACACTTACAGGGTAAGG - Exonic
1188570545 X:31580175-31580197 CACAGCATATTCACAGGTTCTGG + Intronic
1189246361 X:39566462-39566484 CCCAGCACAGTGCCAGGCACTGG + Intergenic
1190713886 X:53088245-53088267 CACAGCACAGGGAGAGGGGCTGG - Exonic
1191035447 X:56021820-56021842 CAAAGCACAGTGCCAAGGTGGGG - Intergenic
1191884465 X:65874433-65874455 AACAGCACAGTGACAGGGACAGG + Intergenic
1192704822 X:73518616-73518638 CACAGCAAAGTCATGGGGTCAGG - Intergenic
1194805906 X:98327929-98327951 CACAGTACACAGACAGGATCTGG + Intergenic
1197803858 X:130380597-130380619 CACAGCACATTGAAAGGCTGAGG + Intergenic
1200076629 X:153554490-153554512 TAGACCACAGTGACAGGGCCAGG + Intronic