ID: 1142179682

View in Genome Browser
Species Human (GRCh38)
Location 16:88662428-88662450
Sequence GGCCAGGTAACCCCGGCGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 53}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142179676_1142179682 28 Left 1142179676 16:88662377-88662399 CCAGTTTCAGAACATTTTGAAAT 0: 1
1: 0
2: 4
3: 40
4: 465
Right 1142179682 16:88662428-88662450 GGCCAGGTAACCCCGGCGCGAGG 0: 1
1: 0
2: 0
3: 3
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142179682 Original CRISPR GGCCAGGTAACCCCGGCGCG AGG Intronic
900126713 1:1072012-1072034 GGCCAGGCGGCCCCGGCGGGGGG + Exonic
902214266 1:14924521-14924543 ACCCGGGGAACCCCGGCGCGGGG - Intronic
902690534 1:18107949-18107971 GGCCAGGCAGCCCGGGCGCCCGG - Exonic
902815110 1:18911946-18911968 GGCGAGGTAAGCCCAGCGCCTGG - Exonic
902870719 1:19312232-19312254 GGCCCGGTCAGCCCAGCGCGCGG + Intergenic
904701806 1:32362274-32362296 GGCCAGGGCAACCCGCCGCGAGG + Exonic
914918001 1:151830175-151830197 GGCCAGGGAAGCCTGGCCCGTGG - Intronic
917329671 1:173868456-173868478 GGCGAGGTGACCCCGGTGCAGGG - Intronic
921089483 1:211830166-211830188 GCCGAGGTGAGCCCGGCGCGCGG - Intronic
1069572253 10:69501343-69501365 GGTCAGATAACCCCGGCCAGGGG - Intronic
1073181807 10:101588054-101588076 GGCCAGGGAATCCCAGCTCGGGG + Exonic
1077556619 11:3229064-3229086 GGCCAGGTAACCATGGGGAGGGG - Intronic
1079569440 11:21924081-21924103 TGCCAGGTAACCTGGGCGCAGGG + Intergenic
1091550157 12:1530605-1530627 GGCCAGGCAGCCCCGGCGCTCGG - Intronic
1102300319 12:111766779-111766801 CGCTAGGTACCCCCGGCCCGTGG - Intronic
1102474013 12:113176953-113176975 GGCCAGGTGACCCCAGGGCCAGG + Intronic
1105009743 12:132747638-132747660 GGCCAGGGAACCCCAGCGCTCGG + Intronic
1130323882 15:82863190-82863212 GGCCAGGGAAGCCCGGGGAGGGG - Intronic
1132626737 16:894948-894970 GGGCAGGGAGCCCCGGGGCGGGG + Intronic
1132695430 16:1199740-1199762 GGGCAGGGAACCCCGGGGTGTGG - Intronic
1133060550 16:3171790-3171812 GACCCGGTAACCCCGGCGCAGGG + Intergenic
1142179682 16:88662428-88662450 GGCCAGGTAACCCCGGCGCGAGG + Intronic
1152490038 17:80625044-80625066 GGCCAGGTGACCCGGGGGAGGGG + Intronic
1160806469 19:994345-994367 GGCCCGGAGACCCCGGCCCGAGG + Exonic
1166216941 19:41341999-41342021 GGCCAGGTCACCTCGGCGGCCGG + Exonic
1167942502 19:52958951-52958973 GGTCAGGTAACCCCAGGGCTGGG - Intronic
935970694 2:108528320-108528342 GGTCAGGTAGCCCCGGGGCTGGG - Intergenic
948565028 2:238879463-238879485 GGCCAGGTAGTCCCGGCTGGAGG - Intronic
949035913 2:241815690-241815712 GGCCACCTGACCCCGGCCCGTGG + Intronic
1176061236 20:63173824-63173846 GGCCAGGTAAGCACTGCGCCTGG - Intergenic
1176206478 20:63891378-63891400 GGCCAGGGAAGCCCAGCGCTCGG + Exonic
1182445530 22:30387345-30387367 GGCCAGGGGTCCCGGGCGCGGGG + Exonic
949860642 3:8501713-8501735 GGCCAGCCAATCCCAGCGCGAGG - Exonic
954293611 3:49662409-49662431 GGGCAGGTATCCCCGCCGGGAGG - Exonic
960925894 3:122794947-122794969 GGCGAGGAAACACCGGCGAGAGG - Exonic
967867815 3:194204415-194204437 GGCCAGGTAGCGCCGCGGCGGGG - Intergenic
968010503 3:195271127-195271149 GGCCACTTAGCCCCGGCGCCAGG + Exonic
968915282 4:3494564-3494586 GGCCAGGGAAGCCGGGCCCGGGG - Intronic
972385241 4:38559647-38559669 GGCCAGCCAACCCCGGTGCTGGG + Intergenic
972654162 4:41049435-41049457 GGCCAGCCAACCCCTCCGCGAGG + Intronic
974787380 4:66636727-66636749 GGCCATGTAACCCTGGGCCGGGG + Intergenic
982712176 4:158768865-158768887 GCTCACGTAACCCCGGCGGGAGG - Intergenic
992431457 5:76715352-76715374 GCGCAGGTGACCCCGGCGGGCGG + Intergenic
1002091606 5:176809954-176809976 GGCCAGGGCACCTCTGCGCGCGG + Intergenic
1002591025 5:180291831-180291853 GGCGAGGTGAGCCCGGCGGGCGG - Exonic
1011564319 6:88658455-88658477 GGCCAGGTAGCCCCGCTGGGTGG + Intronic
1019177280 6:170166563-170166585 AGCCAGGTGACCCCGGCACCCGG + Intergenic
1019515999 7:1440442-1440464 GGCCAGGTCACCCCTGCCTGAGG - Intronic
1019611055 7:1936816-1936838 GGCCAGGCAGCGCCTGCGCGAGG - Exonic
1036659706 8:10700094-10700116 GTCCAGGCAACCACGGCCCGTGG + Intronic
1041234391 8:55784844-55784866 GGCCATGTAACCCTGGTACGTGG - Intronic
1057222130 9:93263071-93263093 GGCCAGGAAACCCAGGATCGGGG - Intronic
1059251497 9:112890989-112891011 GTCCAGGGAAGCCAGGCGCGGGG + Intergenic
1062610588 9:137371679-137371701 GGCCAGGCACCCCCGGGGCTGGG + Intronic
1185637305 X:1562194-1562216 GGCCAGGTGACCCTGTCCCGGGG + Intergenic
1194241501 X:91455802-91455824 GGCCAGGTAACCCAGGCCATGGG + Intergenic
1198479837 X:137031222-137031244 GAGCAGGTAACCGCGGCGCTGGG + Exonic