ID: 1142183112

View in Genome Browser
Species Human (GRCh38)
Location 16:88681290-88681312
Sequence CAGCCCGGCCAGCGTGTGGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142183102_1142183112 15 Left 1142183102 16:88681252-88681274 CCCACCTGCAGGTGGCAGTGCAG 0: 1
1: 0
2: 0
3: 29
4: 345
Right 1142183112 16:88681290-88681312 CAGCCCGGCCAGCGTGTGGTAGG 0: 1
1: 0
2: 3
3: 13
4: 142
1142183103_1142183112 14 Left 1142183103 16:88681253-88681275 CCACCTGCAGGTGGCAGTGCAGC 0: 1
1: 0
2: 5
3: 63
4: 371
Right 1142183112 16:88681290-88681312 CAGCCCGGCCAGCGTGTGGTAGG 0: 1
1: 0
2: 3
3: 13
4: 142
1142183101_1142183112 16 Left 1142183101 16:88681251-88681273 CCCCACCTGCAGGTGGCAGTGCA 0: 1
1: 1
2: 0
3: 33
4: 304
Right 1142183112 16:88681290-88681312 CAGCCCGGCCAGCGTGTGGTAGG 0: 1
1: 0
2: 3
3: 13
4: 142
1142183104_1142183112 11 Left 1142183104 16:88681256-88681278 CCTGCAGGTGGCAGTGCAGCTGC 0: 1
1: 0
2: 5
3: 57
4: 485
Right 1142183112 16:88681290-88681312 CAGCCCGGCCAGCGTGTGGTAGG 0: 1
1: 0
2: 3
3: 13
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142183112 Original CRISPR CAGCCCGGCCAGCGTGTGGT AGG Exonic
900890904 1:5449026-5449048 GAGCCCGGGGAGCCTGTGGTTGG - Intergenic
901054021 1:6440419-6440441 CAGCCCAGTCATCGTGTGGTTGG + Exonic
901187559 1:7384917-7384939 CAGCCAGGCGAGCGTGGGGATGG + Intronic
902480270 1:16707891-16707913 CAGCCCGGTCATCGTGTGGTTGG - Intergenic
903551438 1:24159688-24159710 CAGCCAGGACAGAGTGGGGTTGG + Intronic
903738775 1:25546082-25546104 CTGCCAGCCCAGCGTGGGGTAGG - Intronic
903779813 1:25814096-25814118 CAGGCCAGCCAGCTTCTGGTGGG - Exonic
906102664 1:43273102-43273124 CAGCCCGGCCAGGGTCAGGCCGG - Exonic
906145624 1:43558507-43558529 CACCCCGGCCAGCTTGTGCTGGG - Intronic
911150671 1:94594530-94594552 CAGCCTGGCCAGCAGGTGCTTGG + Intergenic
913449707 1:118984824-118984846 CAGTCCGGCCTGCGCGTTGTAGG - Intronic
914667358 1:149842258-149842280 CAGCCCGGCCCGCGTCTCGAAGG - Exonic
914668409 1:149851532-149851554 CAGCCCGGCCCGCGTCTCGAAGG + Exonic
914932817 1:151949895-151949917 CAGCTCTGCCAGCGTGGCGTTGG + Intergenic
916601490 1:166297584-166297606 CAGGCCGACCAGTGAGTGGTGGG + Intergenic
919931366 1:202223407-202223429 CAGCCTGGAGAGCGTGTGCTTGG - Intronic
922831757 1:228557794-228557816 CTGCCCGGCCGGCGTGCAGTAGG + Intergenic
922832237 1:228609776-228609798 CTGCCCGGCCGGCGTGCAGTAGG + Intergenic
922832797 1:228612017-228612039 CTGCCCGGCCGGCGTGCAGTAGG + Intergenic
922833358 1:228614258-228614280 CTGCCCGGCCGGCGTGCAGTAGG + Intergenic
922835586 1:228623175-228623197 CTGCCCGGCCGGCGTGCAGTAGG + Intergenic
922838380 1:228634379-228634401 CTGCCCGGCCGGCGTGCAGTAGG + Intergenic
922838938 1:228636604-228636626 CTGCCCGGCCGGCGTGCAGTAGG + Intergenic
922839498 1:228638845-228638867 CTGCCCGGCCGGCGTGCAGTAGG + Intergenic
922840059 1:228641076-228641098 CTGCCCGGCCGGCGTGCAGTAGG + Intergenic
922840619 1:228643317-228643339 CTGCCCGGCCGGCGTGCAGTAGG + Intergenic
924578232 1:245300315-245300337 CTGCCCGGCCAGAGTCTGGCTGG + Intronic
1071431504 10:85610588-85610610 CAGCCCAGCCAGGGCATGGTGGG - Intronic
1071475189 10:86019493-86019515 CTGGCTGGCCAGGGTGTGGTTGG - Intronic
1075159627 10:120011867-120011889 TTGCCCGGCCAGCGTGCGGTGGG - Intergenic
1077042222 11:529885-529907 CAGCTAGGCCAGTGTGTGGCAGG - Intergenic
1077296129 11:1827054-1827076 CAGCCCGGGCAGCCAGTGGGTGG + Intergenic
1083626375 11:64074045-64074067 CAGCCCGGCCAGCTGGGGATGGG + Intronic
1083635193 11:64117124-64117146 CATCTTGGCCAGCGTGTTGTAGG - Exonic
1083869193 11:65476763-65476785 CAGCAAGGCCAGGGTGCGGTCGG + Intergenic
1085477203 11:76796137-76796159 CAGGCCGGCCCTCGTGGGGTGGG - Exonic
1087217106 11:95506010-95506032 AAGCCCGGCTAGTCTGTGGTTGG + Intergenic
1090333442 11:125948013-125948035 CAGCACAGCCAGCGTGAGGTGGG - Intergenic
1090831746 11:130425276-130425298 CAGCCCGGGCATCCTGGGGTCGG + Intronic
1091276854 11:134358605-134358627 CACACCGGCCAGCGTGGGGAAGG + Intronic
1096245268 12:49981386-49981408 CAGCCAGGCCAGCGTGTGGCAGG + Intronic
1097989987 12:65824493-65824515 CAGCCCGGGCAGCGCGCGCTTGG + Exonic
1098302350 12:69067155-69067177 CAGCCCTGCCAGCATGTGGCTGG + Intergenic
1105000578 12:132687613-132687635 GCGCCCGGCCAGCCTGAGGTGGG + Exonic
1108407915 13:50124011-50124033 CAGCCCAGCGGGTGTGTGGTTGG - Intronic
1110705261 13:78596839-78596861 CAGCCCGGCGCGCGTGGGGAAGG - Intergenic
1112528891 13:100181461-100181483 CGGCCAGGCTAGAGTGTGGTAGG + Intronic
1118837590 14:69487615-69487637 CAGCCCTGCCTGCCTGGGGTGGG + Intronic
1121919029 14:97863272-97863294 CAGCCATACCAGCGTCTGGTGGG - Intergenic
1122782519 14:104149663-104149685 CTGCCTGGCCAGCCCGTGGTGGG + Intronic
1123057028 14:105575508-105575530 CAGCCTGGCCACGCTGTGGTGGG - Intergenic
1124149809 15:27167475-27167497 CAGCACTGCCTGCATGTGGTGGG + Intronic
1124581572 15:30960279-30960301 CAGCCCAGCCAGCCTGAGATGGG + Intronic
1124592948 15:31069522-31069544 GAGCCCTGCCAGCGTGGGGGAGG - Intronic
1125744304 15:41988241-41988263 CAGCCTGGCTTGCGTGGGGTGGG - Intronic
1128066214 15:64766265-64766287 CAGCAGGGCCTGGGTGTGGTGGG - Intronic
1129361915 15:75029623-75029645 CAGCCAGGCCAGAGTGGGGGAGG + Intronic
1129471662 15:75758837-75758859 CAGGCCGGCCGGCTTGTGGAGGG + Intergenic
1130115078 15:80999766-80999788 CAGCACGCCCAGCCTGTGTTGGG + Intergenic
1130651621 15:85765147-85765169 CAGCCCGGCTGGCCTGGGGTGGG + Intronic
1132320223 15:100919698-100919720 GAGCCCAGCCAGCCTGTGGGAGG + Intronic
1133220430 16:4317112-4317134 CAGCCTGGCCAGAGGGTGGCCGG + Intronic
1137556320 16:49472693-49472715 CAGCCCATCCAGGGTGGGGTAGG - Intergenic
1138607841 16:58100026-58100048 CAGCCTGGCCCACGTGTGGCTGG + Intergenic
1140018753 16:71216006-71216028 CAGCCCGACCAGCAAGTGCTTGG - Intronic
1141596491 16:85100123-85100145 CAGCCAGGTGAGCGTGTGGGTGG - Exonic
1142183112 16:88681290-88681312 CAGCCCGGCCAGCGTGTGGTAGG + Exonic
1142367953 16:89660195-89660217 CAGTCCTGCCTGCGTGTGGGGGG - Intronic
1143253921 17:5541946-5541968 CAGCTCGGTCAGGGTCTGGTTGG + Exonic
1144756002 17:17681244-17681266 CAGGCCGGCCAGCGGGCGGGGGG + Intergenic
1147918124 17:43900612-43900634 CAGCCCGGCCAGGCTTTGGCTGG - Intronic
1148438410 17:47699313-47699335 GAGCCCGGCCAGCCTGCTGTCGG - Exonic
1149646077 17:58242590-58242612 CTGCCCTGACAGCCTGTGGTCGG - Intronic
1151349308 17:73522308-73522330 CAGCCAGGCCAGGATGAGGTGGG - Intronic
1152044349 17:77926003-77926025 CAGCCCAGCCATCGGATGGTGGG - Intergenic
1152364115 17:79845104-79845126 CAGCCCGGCCGCCGTGGGGAGGG - Intergenic
1152738194 17:82007699-82007721 CGGCCAGGCCAGCCTGTGGCAGG - Intronic
1152800698 17:82329478-82329500 CAGCCCTGACAGGGTGGGGTGGG - Intronic
1153813143 18:8769671-8769693 CAGCCTGGCCAGCAAGTGGAAGG - Intronic
1160810101 19:1009566-1009588 CCGGTCGGCCAGAGTGTGGTGGG - Exonic
1162057193 19:8071767-8071789 CAGCCCGGCCAGGGTCTGTATGG + Intronic
1162761509 19:12891389-12891411 CAGACCGGTCAGTGTGGGGTCGG + Exonic
1163725826 19:18922523-18922545 CAGCCCAGACAGCGTGGGGAGGG + Intronic
1166391338 19:42410490-42410512 CAGCTCGGCCAGGTTGTGGCTGG + Exonic
1166539465 19:43595667-43595689 CAGCCTGGCCAACATGTGGGGGG + Intronic
1166986217 19:46661146-46661168 CAGCCCGGCCAGCGGGCGGGCGG - Intergenic
1168511485 19:56977227-56977249 CAGCATGGCCAGGGGGTGGTGGG + Intergenic
1168650649 19:58090058-58090080 CAGCCGGGCCAGGGTCTGGTGGG + Exonic
1202714309 1_KI270714v1_random:33801-33823 CAGCCCGGTCATCGTGTGGTTGG - Intergenic
925462005 2:4071593-4071615 CAGCCCGGGATGTGTGTGGTGGG - Intergenic
926120593 2:10239411-10239433 CAGCACGGCCAGCCTCTGGAGGG - Intergenic
932334306 2:70921214-70921236 CAGCGCTGCCAGTATGTGGTGGG + Exonic
935206889 2:100903896-100903918 AACCCAGGCCTGCGTGTGGTAGG + Intronic
935481089 2:103591409-103591431 CAGCCCTTCCAGCCTGTTGTGGG + Intergenic
937988870 2:127651259-127651281 CAGGCAGACCACCGTGTGGTTGG - Exonic
938407482 2:131040502-131040524 CAGCGCGGACAGCGGGTGGCTGG + Intronic
940650395 2:156435811-156435833 CAGCCCCGCCAGCGTGCCGGCGG + Intronic
945165101 2:206934935-206934957 CACCCTGGCCAACATGTGGTAGG - Intergenic
948566469 2:238890320-238890342 CAGCCCGGCCTGCGCGGGGCAGG + Intronic
1179632546 21:42687785-42687807 CAGCCTGACCAAGGTGTGGTGGG - Intronic
1180014260 21:45072601-45072623 AGGCCCGGCCAGCCTGCGGTGGG + Intergenic
1180045300 21:45302425-45302447 CAGCCCAGCGAGGGTGAGGTGGG - Intergenic
1180052215 21:45336333-45336355 CAGCCTGGGCAGAGCGTGGTGGG + Intergenic
1182522196 22:30891005-30891027 CAGCTTGGCCAGAGTGTGGGTGG - Intronic
1183272639 22:36871717-36871739 GAGCCTGGCCAGCGTGGGGGCGG - Intronic
1183378876 22:37480692-37480714 CTGCCCGGCCTGGGTGTGGTGGG - Intronic
1183720800 22:39560283-39560305 GAGCCCTGCCAGCGTGGGGGAGG - Intergenic
1184366081 22:44052299-44052321 CAGCCCTGCCTGCCTGTGTTTGG - Intronic
950262595 3:11553639-11553661 CAGCCCAGCCAGGCTGTGGATGG - Intronic
954105805 3:48409326-48409348 CACCCGGCCCAGCTTGTGGTCGG + Exonic
956436465 3:69238862-69238884 CAGCCTGGGCAGAGAGTGGTAGG - Intronic
957176283 3:76814871-76814893 CAGCCAGGCCAGTATGTGTTGGG + Intronic
964445132 3:156750565-156750587 CAGGCCTGCCAGTGTGTGGGTGG + Intergenic
968055000 3:195684413-195684435 CAGCCAGCCGAGGGTGTGGTAGG + Intergenic
968055013 3:195684477-195684499 CAGCCAGCCGAGGGTGTGGTAGG + Intergenic
968100888 3:195964736-195964758 CAGCCAGCCGAGGGTGTGGTAGG - Intergenic
968451805 4:679443-679465 CAGCACAGCCCGAGTGTGGTGGG + Intronic
969613018 4:8237498-8237520 CAGGGCGGCCAGCCGGTGGTAGG - Exonic
983956493 4:173704504-173704526 GCGTCGGGCCAGCGTGTGGTAGG + Intergenic
984937171 4:184899505-184899527 CAGCCAGGCCTGCTTGTGGGCGG - Intergenic
985502174 5:255052-255074 CAGCCAGCCGAGGGTGTGGTAGG + Intronic
985502189 5:255119-255141 CAGCCAGCCGAGGGTGTGGTAGG + Intronic
985734847 5:1573615-1573637 CAGCCAGCCGAGGGTGTGGTAGG - Intergenic
992952943 5:81878671-81878693 CAGCCAGGCCACAGTTTGGTAGG - Intergenic
993902998 5:93596948-93596970 CAGCCCGGCCTGGGTCGGGTGGG - Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
998300152 5:141010222-141010244 CAGCCCCGCCAGTGAGAGGTTGG + Exonic
999246543 5:150158005-150158027 CAGCCAGGCCAGCCTGGGGGAGG + Intergenic
1002394179 5:178940674-178940696 CGGGCGGGCCAGCGTGTGCTGGG - Intergenic
1007074815 6:39059746-39059768 CAGCTTGGCCAGCGTCTGCTGGG + Intronic
1018056103 6:160053741-160053763 CACCCAGGCTAGCGTGTAGTGGG + Intronic
1019625457 7:2013666-2013688 CAGCCCCGCCTGGGCGTGGTGGG - Intronic
1019735262 7:2647222-2647244 GACCCCGGCCACCGTGCGGTTGG - Exonic
1029390301 7:100270338-100270360 CAGCCCGGCTAGGGAGTGGGGGG + Intronic
1029650772 7:101890016-101890038 CACTCCCGCCAGTGTGTGGTGGG + Intronic
1032168126 7:129561867-129561889 CAGCCTTGCCTGCCTGTGGTCGG - Intergenic
1033306685 7:140230650-140230672 CCGCCCGGCCGGCGTGGTGTGGG - Intergenic
1037886801 8:22599770-22599792 GAGCCCGGCCAGCCTGGGGGTGG - Intronic
1041889664 8:62855258-62855280 CAGCCTGGCCACAGTGTGGAAGG + Intronic
1042964658 8:74337589-74337611 CAGCACAGTCAGCGTGTGGGTGG - Intronic
1049384946 8:142338457-142338479 CAGCCAGGCAGGCTTGTGGTGGG - Intronic
1049594033 8:143475340-143475362 CCGACCGGCTAGCGTGTGGTGGG - Intronic
1049642971 8:143723664-143723686 CAGGCTGGGCAGTGTGTGGTGGG + Intergenic
1049797061 8:144501671-144501693 CAGGTCAGCCAGGGTGTGGTGGG - Exonic
1051455229 9:17247870-17247892 CAGCCAGGCTAGAGTGTGGTGGG + Intronic
1053181937 9:35980236-35980258 CAACCCGGCCAGAGTGTGGGAGG + Intergenic
1054283065 9:63141541-63141563 CAGCCTGGCCACCGGGTGGGAGG + Intergenic
1061801278 9:133114597-133114619 CAGCCCGGCCAGAGTGCCCTGGG - Intronic
1062615318 9:137393527-137393549 TAGCCAGGTCAGCGTGTGCTCGG - Intronic
1062729464 9:138101025-138101047 CCGCCCGCCCAGCCTGTGATGGG - Intronic
1185601921 X:1346024-1346046 CACCACGCCCAGCGTGGGGTTGG - Intronic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1188480356 X:30630749-30630771 CGGGCCGGCCAGCCTGTGGAGGG - Intergenic
1190106829 X:47567032-47567054 CAGCCCAGCCAGCGTGTCCTCGG + Exonic
1194916986 X:99719309-99719331 CAGCCTGGCCACAGTGTGGAAGG + Intergenic
1198005551 X:132489572-132489594 CAGCCCGGGCTGCCTGGGGTCGG - Intronic
1198936089 X:141903797-141903819 CAGCCCGGATAGCGTGGGGCGGG - Intergenic
1198960248 X:142175253-142175275 CAGCAGGGGCAGCGTGTGGCGGG + Intergenic
1200145001 X:153921859-153921881 CAGCCAGGCCAGCGTGGGATGGG + Intronic