ID: 1142184028

View in Genome Browser
Species Human (GRCh38)
Location 16:88686007-88686029
Sequence TGGGGCTGTAGTGGTTGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142184016_1142184028 20 Left 1142184016 16:88685964-88685986 CCAAACGTGTGCGCCAGGAAGAT 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1142184028 16:88686007-88686029 TGGGGCTGTAGTGGTTGGGACGG No data
1142184023_1142184028 -7 Left 1142184023 16:88685991-88686013 CCAGGGTGCCTTTAGCTGGGGCT 0: 1
1: 0
2: 1
3: 11
4: 203
Right 1142184028 16:88686007-88686029 TGGGGCTGTAGTGGTTGGGACGG No data
1142184015_1142184028 21 Left 1142184015 16:88685963-88685985 CCCAAACGTGTGCGCCAGGAAGA 0: 1
1: 0
2: 2
3: 2
4: 45
Right 1142184028 16:88686007-88686029 TGGGGCTGTAGTGGTTGGGACGG No data
1142184014_1142184028 24 Left 1142184014 16:88685960-88685982 CCTCCCAAACGTGTGCGCCAGGA 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1142184028 16:88686007-88686029 TGGGGCTGTAGTGGTTGGGACGG No data
1142184019_1142184028 7 Left 1142184019 16:88685977-88685999 CCAGGAAGATGACTCCAGGGTGC 0: 1
1: 0
2: 1
3: 18
4: 164
Right 1142184028 16:88686007-88686029 TGGGGCTGTAGTGGTTGGGACGG No data
1142184011_1142184028 26 Left 1142184011 16:88685958-88685980 CCCCTCCCAAACGTGTGCGCCAG 0: 1
1: 0
2: 0
3: 8
4: 56
Right 1142184028 16:88686007-88686029 TGGGGCTGTAGTGGTTGGGACGG No data
1142184012_1142184028 25 Left 1142184012 16:88685959-88685981 CCCTCCCAAACGTGTGCGCCAGG No data
Right 1142184028 16:88686007-88686029 TGGGGCTGTAGTGGTTGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142184028 Original CRISPR TGGGGCTGTAGTGGTTGGGA CGG Intronic