ID: 1142185813

View in Genome Browser
Species Human (GRCh38)
Location 16:88694261-88694283
Sequence CAGGATCTGCTGAGCTCTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142185807_1142185813 0 Left 1142185807 16:88694238-88694260 CCTGAGGTCTCGTCCCACCATGG No data
Right 1142185813 16:88694261-88694283 CAGGATCTGCTGAGCTCTGACGG No data
1142185806_1142185813 5 Left 1142185806 16:88694233-88694255 CCGTGCCTGAGGTCTCGTCCCAC No data
Right 1142185813 16:88694261-88694283 CAGGATCTGCTGAGCTCTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142185813 Original CRISPR CAGGATCTGCTGAGCTCTGA CGG Intergenic
No off target data available for this crispr