ID: 1142186249

View in Genome Browser
Species Human (GRCh38)
Location 16:88696039-88696061
Sequence AACTGCCTGTAGTTCTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142186249_1142186251 13 Left 1142186249 16:88696039-88696061 CCCTCAGAGAACTACAGGCAGTT No data
Right 1142186251 16:88696075-88696097 GTATGCTCAGAAACCAATCCAGG No data
1142186249_1142186255 27 Left 1142186249 16:88696039-88696061 CCCTCAGAGAACTACAGGCAGTT No data
Right 1142186255 16:88696089-88696111 CAATCCAGGAGGTGCTGAGGTGG No data
1142186249_1142186252 16 Left 1142186249 16:88696039-88696061 CCCTCAGAGAACTACAGGCAGTT No data
Right 1142186252 16:88696078-88696100 TGCTCAGAAACCAATCCAGGAGG No data
1142186249_1142186253 24 Left 1142186249 16:88696039-88696061 CCCTCAGAGAACTACAGGCAGTT No data
Right 1142186253 16:88696086-88696108 AACCAATCCAGGAGGTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142186249 Original CRISPR AACTGCCTGTAGTTCTCTGA GGG (reversed) Intergenic
No off target data available for this crispr