ID: 1142187015

View in Genome Browser
Species Human (GRCh38)
Location 16:88699408-88699430
Sequence TGAGCTGTCCCTACCCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 150}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142187008_1142187015 -8 Left 1142187008 16:88699393-88699415 CCTGCTCCCCACAGCTGAGCTGT 0: 1
1: 0
2: 1
3: 42
4: 336
Right 1142187015 16:88699408-88699430 TGAGCTGTCCCTACCCCAGGGGG 0: 1
1: 0
2: 1
3: 17
4: 150
1142187003_1142187015 9 Left 1142187003 16:88699376-88699398 CCGGCCTGCGCCCTCCTCCTGCT 0: 1
1: 1
2: 5
3: 102
4: 872
Right 1142187015 16:88699408-88699430 TGAGCTGTCCCTACCCCAGGGGG 0: 1
1: 0
2: 1
3: 17
4: 150
1142187004_1142187015 5 Left 1142187004 16:88699380-88699402 CCTGCGCCCTCCTCCTGCTCCCC 0: 1
1: 1
2: 19
3: 241
4: 1883
Right 1142187015 16:88699408-88699430 TGAGCTGTCCCTACCCCAGGGGG 0: 1
1: 0
2: 1
3: 17
4: 150
1142187007_1142187015 -5 Left 1142187007 16:88699390-88699412 CCTCCTGCTCCCCACAGCTGAGC 0: 1
1: 0
2: 7
3: 72
4: 535
Right 1142187015 16:88699408-88699430 TGAGCTGTCCCTACCCCAGGGGG 0: 1
1: 0
2: 1
3: 17
4: 150
1142187002_1142187015 10 Left 1142187002 16:88699375-88699397 CCCGGCCTGCGCCCTCCTCCTGC 0: 1
1: 1
2: 10
3: 102
4: 1032
Right 1142187015 16:88699408-88699430 TGAGCTGTCCCTACCCCAGGGGG 0: 1
1: 0
2: 1
3: 17
4: 150
1142187006_1142187015 -2 Left 1142187006 16:88699387-88699409 CCTCCTCCTGCTCCCCACAGCTG 0: 1
1: 1
2: 7
3: 118
4: 1016
Right 1142187015 16:88699408-88699430 TGAGCTGTCCCTACCCCAGGGGG 0: 1
1: 0
2: 1
3: 17
4: 150
1142187005_1142187015 -1 Left 1142187005 16:88699386-88699408 CCCTCCTCCTGCTCCCCACAGCT 0: 1
1: 0
2: 11
3: 130
4: 1107
Right 1142187015 16:88699408-88699430 TGAGCTGTCCCTACCCCAGGGGG 0: 1
1: 0
2: 1
3: 17
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142187015 Original CRISPR TGAGCTGTCCCTACCCCAGG GGG Intronic
901023954 1:6269382-6269404 TGAGCTTGGCCTCCCCCAGGCGG + Intronic
901775723 1:11559471-11559493 TGAACTGTCCCTATCCCTGTAGG + Intergenic
903757960 1:25676211-25676233 TGAGCTGTCTGGACCTCAGGTGG + Intronic
904946706 1:34204369-34204391 TGAGCTTTCCCTCCCTCGGGAGG - Intronic
905294233 1:36944098-36944120 TGAGCTGTATGTATCCCAGGTGG - Intronic
906096021 1:43224562-43224584 TGAGCTGTCCCCAGCCCATGGGG - Intronic
911703995 1:100989569-100989591 TTAGCTGTCCCTACTGCATGAGG - Intergenic
912254464 1:108045084-108045106 TGAGCTGTCCCTAGACAAGGTGG - Intergenic
914832987 1:151184368-151184390 TGAGCGGCCACTAACCCAGGAGG - Exonic
919755755 1:201065083-201065105 TGCTCTCTCCCTACCCCACGTGG - Intronic
924739507 1:246786683-246786705 GGAGCTGTCCCCAGCCCAGGTGG + Intergenic
1063378907 10:5572039-5572061 GGAGCTGTACCGGCCCCAGGAGG - Intergenic
1067247232 10:44557225-44557247 TGTGCTGTACCAACGCCAGGTGG + Intergenic
1070538076 10:77394200-77394222 TGGGCTGTCCCTGGACCAGGAGG + Intronic
1070815224 10:79318570-79318592 TGTGGTGTCCCTTCCCCAGTTGG + Intergenic
1075654575 10:124152632-124152654 TGTGCTGGCCCCACTCCAGGTGG - Intergenic
1075781262 10:125018705-125018727 TGGGGTGCACCTACCCCAGGTGG - Intronic
1075836720 10:125460118-125460140 TGTGCTGTACCTTCCCCAGGTGG - Intergenic
1076427326 10:130376802-130376824 TGAGCTGTCACTTCTCCAGCAGG - Intergenic
1077522299 11:3043559-3043581 TGACCTGTGCCCACCCCAGCAGG + Intronic
1084172333 11:67406608-67406630 TGCCCTGCCCCTTCCCCAGGAGG + Exonic
1084965038 11:72740025-72740047 AGAGCTGTCTCCAACCCAGGTGG + Intronic
1086506381 11:87508634-87508656 TGAAATCTCCCTTCCCCAGGGGG - Intergenic
1089559165 11:119334995-119335017 TGAGCAGTCTCCAACCCAGGGGG - Exonic
1091686103 12:2563845-2563867 GGAGCTGTCCCTGCCCCCTGGGG + Intronic
1092140604 12:6180762-6180784 GGAGCAGCCCCTGCCCCAGGAGG + Intergenic
1093417767 12:18939995-18940017 GATGCTGCCCCTACCCCAGGTGG + Intergenic
1093904208 12:24670827-24670849 TGAGCTTTAGCTACCCCATGTGG + Intergenic
1094736092 12:33235555-33235577 TGAGCTGTGTTTACTCCAGGGGG + Intergenic
1094812257 12:34149906-34149928 TGAGCTGTCAGTAGCCCAGCAGG - Intergenic
1095969123 12:47889572-47889594 TGAGCTTTCTCTACTCCAGGTGG + Intronic
1096237239 12:49937969-49937991 GCAGCTGTCCTTTCCCCAGGAGG + Intergenic
1098190374 12:67941760-67941782 TGACCTGTCCCTAACCTAAGCGG - Intergenic
1103276053 12:119712648-119712670 TGAGCTGTGCCTTCCCGACGGGG - Exonic
1103561395 12:121794843-121794865 TGGGCTCTTCCTACCCCAGCTGG - Intronic
1103726355 12:122999226-122999248 TGGGCTGCCCTCACCCCAGGAGG + Intronic
1104755466 12:131266649-131266671 TGACCCCTCCCTCCCCCAGGGGG - Intergenic
1105422689 13:20266835-20266857 TGAGCTCTCCCGGCCCCTGGTGG + Intergenic
1105779777 13:23695997-23696019 TGAGCCGCCCCAACCCCCGGGGG - Intergenic
1107920791 13:45205056-45205078 TTAGCAGTACCTACTCCAGGTGG - Intronic
1107987666 13:45789175-45789197 TAAGATGTTCCTATCCCAGGTGG - Intronic
1113595484 13:111528785-111528807 TGAGCTGTCCAGAGGCCAGGTGG - Intergenic
1115534918 14:34363932-34363954 TAAGCTGCTCCTAGCCCAGGAGG + Intronic
1120019604 14:79513463-79513485 TAATCTGTCCCTAGCACAGGAGG + Intronic
1121282527 14:92709620-92709642 GGTGCTGTCCCCAGCCCAGGTGG - Intronic
1124966093 15:34434567-34434589 TGAGCTGGACCCAACCCAGGCGG + Intronic
1124982706 15:34580650-34580672 TGAGCTGGACCCAACCCAGGCGG + Intronic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1128217703 15:65945692-65945714 GGAGGTGTCCGTTCCCCAGGTGG - Intronic
1132463275 16:66061-66083 GCAGCTGTCCCCAACCCAGGGGG + Intronic
1132537818 16:492081-492103 TGCCCTGTCCCTGCCCCAGGGGG + Intronic
1132841270 16:1979474-1979496 TGAGCTGTCCGTGCCCGCGGGGG - Exonic
1134110828 16:11514547-11514569 TGAGCTGTCCCTTCCCCTCTTGG - Intronic
1136396060 16:29993187-29993209 TGAGCTCTGCCACCCCCAGGAGG - Exonic
1137715265 16:50594688-50594710 TGCCGTGTCCCCACCCCAGGTGG - Intronic
1138339346 16:56278557-56278579 TGAGCTGCCCCCACACCAGCAGG - Intronic
1140101611 16:71922483-71922505 AGATCTGTCTCTACCCCAGGAGG - Exonic
1141697247 16:85625919-85625941 ACAGGAGTCCCTACCCCAGGAGG - Intronic
1142187015 16:88699408-88699430 TGAGCTGTCCCTACCCCAGGGGG + Intronic
1143001264 17:3796679-3796701 TGAGCTGTCCCCAGCCACGGAGG + Intronic
1143203803 17:5129693-5129715 TGAGCTGTCCCCACAGGAGGGGG - Intronic
1143265759 17:5636045-5636067 GCAGCTGTCCCTAGGCCAGGTGG - Intergenic
1144874983 17:18392804-18392826 TGAGCTGTCCCTACAGGAGGGGG - Intergenic
1145094084 17:20009605-20009627 TGTCCTGTCCCCAGCCCAGGAGG + Intronic
1145157241 17:20551617-20551639 TGAGCTGTCCCTACAGGAGGGGG + Intergenic
1145767447 17:27468652-27468674 TGAGCTGTACCTATCTCAGCAGG + Intronic
1147501034 17:40963752-40963774 TGAGGTGTCTCTACGCCAGCTGG - Exonic
1148073661 17:44922937-44922959 TGTGGTGTCCCCACGCCAGGAGG - Intergenic
1148328157 17:46796044-46796066 GGAGCTGTCCCATCCGCAGGTGG + Intronic
1148856178 17:50580383-50580405 TCAGGTGCCCCTCCCCCAGGGGG + Intronic
1151601687 17:75109929-75109951 CGCGCTGTCCCTACCCCCGAAGG - Intergenic
1151869611 17:76827441-76827463 TTGGCTGTCCCTTCCCCACGTGG + Intergenic
1152094173 17:78263538-78263560 GGAGCTGGCCCTACCCCAGATGG - Intergenic
1152420395 17:80189734-80189756 TGACCTCTCTCTGCCCCAGGCGG + Exonic
1152424258 17:80210439-80210461 TGAGCTGTGACCATCCCAGGAGG - Exonic
1203159886 17_GL000205v2_random:39323-39345 TTTGCTGCCCCTGCCCCAGGGGG - Intergenic
1154024914 18:10697963-10697985 TGAGCTATCCCTCCACCATGTGG - Intronic
1157332826 18:46716013-46716035 TGAGCTGTCCACAGCCCAGAAGG + Intronic
1160036036 18:75302594-75302616 TGAGCTGACCCTTGGCCAGGCGG + Intergenic
1160553320 18:79709904-79709926 TGATCTTTCCTAACCCCAGGCGG - Intronic
1161090159 19:2355980-2356002 TAAGCCGTCCCTTCCCCAGTGGG - Intergenic
1162029005 19:7909441-7909463 TGAGGTGTCCCTCGGCCAGGGGG - Intronic
1165374083 19:35429371-35429393 AGAGCTGTCCATAACCCATGTGG - Intergenic
1165682861 19:37792338-37792360 AGATCTGTCTCTACCCCAGAAGG - Intronic
1166023115 19:40050899-40050921 TGAACTGTACTTACCCCAGCTGG - Intronic
1168368784 19:55813656-55813678 TGTGCTGTCCCTTCCTCATGAGG - Intronic
927204606 2:20599220-20599242 GGAGCTGTCCTGGCCCCAGGGGG + Intronic
931651566 2:64473252-64473274 TGCACTGTCCCTCCCCCATGTGG - Intergenic
931998971 2:67866241-67866263 GGTGATGTCCCTAGCCCAGGTGG - Intergenic
932763321 2:74454902-74454924 TGGGCTGTCCCGACCTCAGAGGG + Intergenic
935331013 2:101978291-101978313 TCAGCTGTCCAATCCCCAGGGGG - Intergenic
935983962 2:108654495-108654517 TGATGGGTCCCTTCCCCAGGAGG - Intronic
936136397 2:109898148-109898170 TGATGGGTCCCTTCCCCAGGAGG - Intergenic
936208300 2:110473337-110473359 TGATGGGTCCCTTCCCCAGGAGG + Intergenic
936854208 2:116937073-116937095 TGAGCTCTCCCACTCCCAGGTGG - Intergenic
938584620 2:132677732-132677754 TGAGACGTGCCTACCCCAAGAGG + Intronic
939018285 2:136927300-136927322 TGAGCTGGACCTGCCTCAGGTGG + Intronic
944402295 2:199341981-199342003 AGAGCTGTCGCTACTACAGGAGG + Intronic
1169313915 20:4572127-4572149 TGAGATGTCACTTCCCCTGGAGG - Intergenic
1175776902 20:61659427-61659449 TGAGCAGACCCCTCCCCAGGTGG - Intronic
1175863345 20:62161699-62161721 CGACCTGTGGCTACCCCAGGAGG - Intronic
1178972731 21:37195283-37195305 AGAGCTGTCTCCATCCCAGGGGG - Intronic
1179627597 21:42657494-42657516 TCAGCTGCCCCTACCCTGGGGGG + Intronic
1183098764 22:35570601-35570623 TGAACCATCCCTTCCCCAGGAGG - Intergenic
1183356122 22:37360585-37360607 TGAGCTGTCCCTGTGCCAGCCGG - Intergenic
1184313147 22:43661680-43661702 TGAGCTCTGCCTCCACCAGGAGG + Intronic
1184492241 22:44816344-44816366 TGAGCTGTCCATGCTCCTGGGGG - Intronic
1184670717 22:46011194-46011216 TGCGCTGGCCCTATCCCAGCTGG - Intergenic
1184793900 22:46719971-46719993 GCAGCTGGCCATACCCCAGGTGG - Intronic
950345590 3:12288712-12288734 TGTGCTGGCCCTACGCCCGGCGG + Intronic
950583447 3:13878062-13878084 GGACCTCTCCCTACCCCAGAGGG + Intronic
951432277 3:22622173-22622195 TTAACTGTGCCTACCCCAAGGGG - Intergenic
954145002 3:48630154-48630176 GGCACTGTCCCCACCCCAGGCGG - Exonic
954760702 3:52871502-52871524 GAAGCTGTCCCTGCCACAGGGGG - Intronic
954906062 3:54063903-54063925 AGAGCAGTCCCTACCCAATGAGG - Intergenic
957229172 3:77489570-77489592 TAAGCTGTCCCTTCCTCAAGGGG - Intronic
961368850 3:126417671-126417693 GGAGATGTCCCTACCCCTGCAGG - Intronic
961521422 3:127469356-127469378 TGAGCTTTCCCTCCCCCACCAGG + Intergenic
962408782 3:135123097-135123119 TTAGGTGCCTCTACCCCAGGTGG + Intronic
962436710 3:135373656-135373678 TGAGCTGTCTCTTCCCCAGGAGG + Intergenic
968077896 3:195826439-195826461 TGTTCGGTCCCAACCCCAGGAGG + Intergenic
969446542 4:7247979-7248001 AGGGCTGTCCCTTCCCCAGAGGG - Intronic
969500794 4:7551582-7551604 AGAGCTGTCCCTACTCCAGTGGG - Intronic
972126820 4:35778086-35778108 TCAAATGTCCCTACCCTAGGAGG - Intergenic
986826166 5:11525284-11525306 TGTGTAGTCCCTTCCCCAGGAGG + Intronic
996036304 5:118762601-118762623 TGACCGCTCCCTTCCCCAGGGGG - Intergenic
997589165 5:135062434-135062456 TGGCCTCTCCCTACCCCAGCAGG - Intronic
998469738 5:142374450-142374472 GGAGCTGTTCCTACCCTGGGAGG + Intergenic
1001447131 5:171794347-171794369 TGATATGTCCCTACCCCATGTGG + Intronic
1001587643 5:172844299-172844321 TCAGCTGTCCCTTCCCCACAGGG - Intronic
1004865809 6:19853078-19853100 TGAGCCGTGCCTAGCCCAGCAGG - Intergenic
1007765229 6:44155884-44155906 CCATCTGTCCCTTCCCCAGGAGG + Intergenic
1008895044 6:56543012-56543034 TGAGCTGTCCCTCTCCCCAGTGG - Intronic
1013115844 6:107103200-107103222 TGTGCTGTCCCTGCGCCAGCTGG - Intronic
1017786850 6:157763465-157763487 GGAGCAGGCCCAACCCCAGGTGG + Intronic
1019294171 7:265250-265272 TGGGCTGACCCCTCCCCAGGAGG - Intergenic
1027250069 7:76393444-76393466 TGTGCTGGCCCCAGCCCAGGTGG + Exonic
1028822252 7:95225913-95225935 CCAGCTGTCCTTACCCCAGGTGG - Intronic
1033510466 7:142055718-142055740 TGCTCTGTCCTTACCCCTGGGGG - Exonic
1033513315 7:142082202-142082224 TGCTCTGTCCTTACCCCTGGGGG - Intronic
1033588752 7:142793293-142793315 TGAAATCTCCCTAACCCAGGGGG + Intergenic
1034730321 7:153381508-153381530 TGAGCTGCCCATCCCCCAGGAGG - Intergenic
1035652488 8:1279032-1279054 TGAGCTATACTCACCCCAGGGGG + Intergenic
1035737060 8:1896840-1896862 GGAGCGGGCCCTACCCGAGGGGG + Intronic
1039898157 8:41730955-41730977 AGAGCTTTCCTTACCCCACGAGG + Intronic
1046102182 8:109628226-109628248 TGAGCTGTCACTACCACACCTGG - Intronic
1048970334 8:139641757-139641779 TCAGCTGGTCCTCCCCCAGGAGG - Intronic
1049028447 8:140014082-140014104 TGAGCTGTCCCCACCACACAGGG + Intronic
1049255807 8:141613121-141613143 TGAGCTGTCCCTTCTCCCAGGGG - Intergenic
1049403586 8:142441822-142441844 TGTGCTGTTCCTGGCCCAGGAGG + Intergenic
1049497160 8:142941439-142941461 CGGCCTGTCCCTGCCCCAGGAGG - Intergenic
1049664531 8:143837095-143837117 TGTGCTGGCCCCACCCCCGGAGG - Exonic
1049988924 9:974961-974983 CGAGGGGTCCCTACCCCACGCGG + Intergenic
1052999226 9:34568352-34568374 TGAGCTGTCCCTCCCCCGTGTGG + Intronic
1056874987 9:90319475-90319497 TGAGCTGTCCTAACCCAAGGTGG + Intergenic
1057947763 9:99344605-99344627 TGAGCTTTCCATGCCCCTGGGGG - Intergenic
1058726553 9:107810249-107810271 TTAGCTGTCTCTACCGTAGGAGG + Intergenic
1060415129 9:123424642-123424664 TGGGCTCTCCCCACCCCAGGTGG - Intronic
1061615296 9:131775104-131775126 TGACCTGGCCCTGCCTCAGGTGG - Intergenic
1062041202 9:134405096-134405118 TGGTCTGTCCCTCCCCCAGTGGG - Intronic
1062186660 9:135222022-135222044 TGTGCTCTCCCTCCCCCAGTTGG + Intergenic
1062321399 9:135992155-135992177 TGAGCTTCCCTTACCCCATGGGG - Intergenic
1189528867 X:41857334-41857356 TGAACCTTCCGTACCCCAGGAGG - Intronic
1190414439 X:50167245-50167267 TTAGCTCTCCCTCCCCCAGAAGG + Intergenic
1194296242 X:92129744-92129766 TGAGCCCTCCCTACCCCTGAAGG - Intronic
1198129582 X:133680277-133680299 TGCTGTATCCCTACCCCAGGTGG + Intronic
1199537012 X:148914142-148914164 TGAGCTCTCCCTATCTCAGCAGG + Intronic
1200613750 Y:5354351-5354373 TGAGCCCTCCCTACCCCTGAAGG - Intronic
1200928320 Y:8674419-8674441 TGAGCTTGCCCTCTCCCAGGTGG + Intergenic