ID: 1142187144

View in Genome Browser
Species Human (GRCh38)
Location 16:88699949-88699971
Sequence GCCGAGGGCAGAAACCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 214}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142187137_1142187144 12 Left 1142187137 16:88699914-88699936 CCATGGCCAAAAGCAAGTCACTG 0: 1
1: 0
2: 1
3: 28
4: 262
Right 1142187144 16:88699949-88699971 GCCGAGGGCAGAAACCTGGCTGG 0: 1
1: 0
2: 0
3: 21
4: 214
1142187136_1142187144 20 Left 1142187136 16:88699906-88699928 CCACTACTCCATGGCCAAAAGCA 0: 1
1: 0
2: 2
3: 17
4: 165
Right 1142187144 16:88699949-88699971 GCCGAGGGCAGAAACCTGGCTGG 0: 1
1: 0
2: 0
3: 21
4: 214
1142187139_1142187144 6 Left 1142187139 16:88699920-88699942 CCAAAAGCAAGTCACTGCAGGAC 0: 1
1: 0
2: 1
3: 13
4: 176
Right 1142187144 16:88699949-88699971 GCCGAGGGCAGAAACCTGGCTGG 0: 1
1: 0
2: 0
3: 21
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142187144 Original CRISPR GCCGAGGGCAGAAACCTGGC TGG Intronic
900102107 1:966355-966377 GCCCAGGGCAGAGACCTGCACGG + Intergenic
900347110 1:2215148-2215170 GAGGAGGGCAGAACACTGGCAGG + Intergenic
900507032 1:3034885-3034907 GCCTGGGGCAGACACCTGGGTGG - Intergenic
900836174 1:5006009-5006031 GCTGATGGCAGATAGCTGGCAGG - Intergenic
901050316 1:6422954-6422976 GGAGAGGACAGAAGCCTGGCAGG + Intronic
902778410 1:18689418-18689440 GGCCAGGGCAGAGCCCTGGCAGG + Intronic
905893840 1:41532885-41532907 GCCGACGGCAGAGACCTGGGTGG + Intronic
906510794 1:46409494-46409516 GCCAAGGGCAGGATCCAGGCAGG + Intronic
910181264 1:84485694-84485716 TCAGAGTGGAGAAACCTGGCAGG - Intronic
910437496 1:87220094-87220116 GGAGAGAGCAGAAACCTGCCTGG + Intergenic
911797780 1:102095842-102095864 ACAGAGGCCAGAGACCTGGCTGG - Intergenic
912374013 1:109195402-109195424 GACAATGGCATAAACCTGGCAGG + Intronic
912477237 1:109946836-109946858 GGTGAGGGGAGAAACCTGCCTGG + Intergenic
913385135 1:118251152-118251174 GCCAAGGGAAGAAAACTGACAGG - Intergenic
915142315 1:153775304-153775326 GCGGAGAGCAGAAACCCGGGAGG - Exonic
915561933 1:156692734-156692756 GGCAGCGGCAGAAACCTGGCAGG - Intergenic
919790143 1:201285343-201285365 GCCGAGGGAAGGAAAATGGCCGG + Intronic
920363544 1:205435960-205435982 GATGAGGGCAGAAACCAGCCTGG + Intronic
922575462 1:226658371-226658393 GCCCTGGTTAGAAACCTGGCTGG + Intronic
923277037 1:232405512-232405534 GCTGGGGGCAGAATCCTGGCTGG + Intronic
1064430367 10:15265726-15265748 GCATAGGGCACAGACCTGGCAGG + Intronic
1065945143 10:30599346-30599368 GCCGTGGGCAGAAGCAGGGCAGG - Intergenic
1066231159 10:33435029-33435051 GATGAGGCCAGAAACCTGACTGG - Intergenic
1067242187 10:44506458-44506480 GCAAAGGACAGAAACCTGGAGGG - Intergenic
1069755344 10:70771372-70771394 GCCGAGGGCAGAGAGCTGAGGGG - Exonic
1070332772 10:75430270-75430292 GCGGAGGGCAGAGTGCTGGCTGG + Intergenic
1073064702 10:100751101-100751123 GCCGGCGGGAGAAGCCTGGCAGG - Intronic
1073827026 10:107336253-107336275 GCGAAGGACACAAACCTGGCTGG - Intergenic
1073920049 10:108448428-108448450 GCAAAAGGCAGAAACATGGCAGG - Intergenic
1076791563 10:132779446-132779468 CCCAAGGGCAGAAGGCTGGCAGG + Intronic
1076797656 10:132805947-132805969 CCCGAGCGCAGAAACCATGCAGG - Intergenic
1077314730 11:1913666-1913688 GCAGAGGGCAGACAGTTGGCTGG + Intergenic
1077981119 11:7301887-7301909 GCCTGGGGCAGAAGCCTGGAGGG + Intronic
1078835498 11:15025631-15025653 ACAGAGGCCAGAAGCCTGGCTGG + Intronic
1080660646 11:34293341-34293363 GCTGAGGGCAGCGTCCTGGCTGG + Intronic
1081617953 11:44601563-44601585 GCAGAGGGCAGAAATGTGGGTGG - Intronic
1081773027 11:45661456-45661478 GCCGGGGGTAGAACCTTGGCAGG + Intronic
1081806012 11:45890933-45890955 GCAGAGGGCAGGAAGATGGCTGG + Intronic
1081870448 11:46380689-46380711 GCAGAGGTCAGGAACCGGGCAGG - Intergenic
1082776680 11:57250486-57250508 TTCGAGGGCAGAATCCTGGGTGG - Intergenic
1083190542 11:61048742-61048764 GCCGAGGGCAGCAGCCAGGAGGG - Intergenic
1083551043 11:63590438-63590460 GCCAAGGGCAGATGCCCGGCTGG - Intronic
1083747181 11:64742992-64743014 CCCGCGGGCAGAAACGGGGCGGG + Intronic
1083859717 11:65413643-65413665 TCCGTGGGCATCAACCTGGCTGG - Intergenic
1084148018 11:67275286-67275308 GCCGAGGTCAGAGGCCAGGCAGG + Intronic
1085047086 11:73359945-73359967 GCAGAGGGCACAGACCTGGTGGG - Exonic
1088813251 11:113405497-113405519 ACAGAGGGCAGGAACCAGGCTGG + Intergenic
1089463020 11:118663797-118663819 GCTTATGGCAGAAACCTGGGAGG + Intronic
1089759584 11:120713315-120713337 GCAGAGGGCACAAAACTGGGAGG - Intronic
1091241195 11:134053601-134053623 GCCCAGAGCAGAAAGCTTGCAGG + Intergenic
1091416865 12:295463-295485 GCTGAGGGCAGTAATCTGGCTGG - Intronic
1092103483 12:5904460-5904482 GCCCAGGGCAGACGCCTCGCAGG + Intronic
1093012736 12:14126057-14126079 GCCCAGGTCAGAAACAGGGCAGG + Intergenic
1094082378 12:26551767-26551789 GACAGAGGCAGAAACCTGGCCGG + Intronic
1094219058 12:27974206-27974228 GCCAAGGGCAGGCATCTGGCTGG - Intergenic
1094655811 12:32418770-32418792 GGGAAGGGCACAAACCTGGCTGG - Intronic
1099854388 12:88144982-88145004 GCCTAGGGCAGAAAGAAGGCAGG - Intronic
1105242612 13:18621260-18621282 GAGGATAGCAGAAACCTGGCAGG + Intergenic
1105631858 13:22177349-22177371 GCCCAGAGCAGAAATTTGGCAGG - Intergenic
1107886635 13:44879151-44879173 GCTCAGGGCAGAGACCTGCCTGG - Intergenic
1108428237 13:50326784-50326806 GCCGAAAGAAGAAACCAGGCAGG - Intronic
1108495957 13:51025662-51025684 GCGGCAGGCAGAAACTTGGCAGG - Intergenic
1111110287 13:83699596-83699618 GGAGAGGGCAGAAACCTAGTGGG + Intergenic
1114265980 14:21072847-21072869 CCAGAGTGCACAAACCTGGCAGG - Intronic
1114461087 14:22886610-22886632 GCAGAGGGCCGCCACCTGGCCGG + Exonic
1118275864 14:64385928-64385950 GCTGAGAGCAGAAACTTTGCTGG + Intergenic
1118719775 14:68585770-68585792 GACGTGGGCAGACGCCTGGCTGG + Intronic
1122292530 14:100687376-100687398 GCCAATGGCAGAAACCTTACTGG + Intergenic
1122616582 14:103022104-103022126 GCCAAGGACAGAACCCTGGGGGG + Intronic
1122780191 14:104140201-104140223 GCCCAGGACAGAAACCAGACTGG - Intronic
1122823585 14:104359147-104359169 GACGAGGGCAGGGAGCTGGCTGG - Intergenic
1123488686 15:20763347-20763369 GAGGACAGCAGAAACCTGGCAGG - Intergenic
1123545182 15:21332420-21332442 GAGGACAGCAGAAACCTGGCAGG - Intergenic
1125745798 15:41996490-41996512 GGTGAGGACAGAGACCTGGCGGG - Intronic
1127343082 15:58066468-58066490 GCAGAGGGCAGCAACTGGGCGGG - Intronic
1128737620 15:70062107-70062129 GCTTCGGGCAGAAACTTGGCCGG - Intronic
1128770211 15:70276503-70276525 GCTGAGAGCCGCAACCTGGCTGG - Intergenic
1128968472 15:72085639-72085661 GCCTAGTTCAGAAACCTTGCTGG + Intronic
1131054633 15:89368228-89368250 GCCGAGGTCAGGTACCTGGTCGG - Intergenic
1131737342 15:95347966-95347988 GCCCAGGGCAGCAACATGGTAGG - Intergenic
1132371417 15:101302023-101302045 GCCCAGGGAAGGAAGCTGGCTGG - Intronic
1202953528 15_KI270727v1_random:59691-59713 GAGGACAGCAGAAACCTGGCAGG - Intergenic
1135704550 16:24663600-24663622 GCTCAGGGCAGAATCCAGGCAGG + Intergenic
1137602955 16:49768980-49769002 GCCCAGGCCAAAAACCTTGCAGG + Intronic
1137717782 16:50609440-50609462 GACCAGGGCAGACAGCTGGCTGG + Intronic
1138537206 16:57666522-57666544 GCTGAGGGCTGAATGCTGGCTGG + Intergenic
1138552213 16:57754125-57754147 GCAGAGGGCAGAGACCCAGCGGG - Intronic
1139254635 16:65529154-65529176 GCTGAGGGCAGAACCCAGGTAGG - Intergenic
1139509052 16:67416138-67416160 TCCGAGGTGAGAAACCGGGCGGG + Intronic
1140454459 16:75096911-75096933 TCCGAGGACAGGCACCTGGCTGG + Intronic
1140658203 16:77162187-77162209 GCCTCAGGGAGAAACCTGGCAGG - Intergenic
1141604336 16:85144440-85144462 GCCCAGGGCAGAAAGCGAGCAGG + Intergenic
1142187144 16:88699949-88699971 GCCGAGGGCAGAAACCTGGCTGG + Intronic
1143018436 17:3904127-3904149 GCCAAGGACAGAAACGTGGCTGG + Intronic
1143729729 17:8874297-8874319 GCCCAGGGCAGGCACCAGGCTGG + Intergenic
1144269402 17:13601948-13601970 GCCGAGGGCAGCAAACTTGCTGG + Intergenic
1147057374 17:37844799-37844821 GCCCGGGGCGGAAACCTGGGCGG - Intergenic
1147993530 17:44349466-44349488 GCAGTGGGCATCAACCTGGCAGG - Exonic
1148753983 17:49963005-49963027 GCCGAGGGTGGAAGCCAGGCTGG + Intergenic
1148965405 17:51430813-51430835 GGGGAGGGCAGATACCTGGAGGG + Intergenic
1149894850 17:60421743-60421765 GCCGAGGGCGGAAACGCGGTGGG - Intronic
1151210235 17:72538975-72538997 GCAGCGGGCAGAAACCGGGCTGG - Intergenic
1151454041 17:74215483-74215505 GCCGGGGCCAGAATCCTGGGAGG - Intronic
1156845942 18:41665361-41665383 GGAGAGAGCAGAAACCTGGTGGG + Intergenic
1157840188 18:50950307-50950329 CCCGGGGGCAGAGCCCTGGCTGG + Exonic
1159506246 18:69340458-69340480 GCTGAAGGCAGAAACCTTTCAGG + Intergenic
1159565039 18:70038199-70038221 GGGAAGGACAGAAACCTGGCTGG + Intronic
1160814840 19:1030235-1030257 GCCGGGTGCAGAAAGGTGGCAGG + Intronic
1160936520 19:1598756-1598778 GCCCAGGACAGCAGCCTGGCAGG + Intronic
1163575711 19:18109898-18109920 GGCGAGGGCAGAGGCCGGGCCGG + Intronic
1163608372 19:18288113-18288135 GGAGAGGGCGGAAGCCTGGCAGG - Intergenic
1163713917 19:18863196-18863218 CCCCATGGCAGACACCTGGCTGG - Intronic
1164180661 19:22815516-22815538 CCTGAGGGCAGAAACCACGCGGG - Intergenic
1164507755 19:28873519-28873541 GCTGAGGGCTGAAACATGCCAGG - Intergenic
1164540721 19:29119770-29119792 CCGGAGGGCAGAAAACTTGCAGG + Intergenic
1166318521 19:42002502-42002524 GCCAAGTGCAGAACACTGGCAGG + Intronic
1166344316 19:42155935-42155957 GCCAGGGGCAGAGACCTGGCAGG + Intronic
1166438403 19:42789202-42789224 GCAGAGGGCAAGAACCTGTCAGG + Intronic
1166467293 19:43043851-43043873 GCAGAGGGCAAGAACCTGTCAGG + Intronic
1166473429 19:43099936-43099958 GCAGAGGGCAAGAACCTGTCAGG + Intronic
1166494222 19:43286940-43286962 GCAGAGGGCAAGAACCTGTCAGG + Intergenic
1168021613 19:53612908-53612930 GCAGAGGGCAGAAGCCTCTCTGG + Intergenic
925276345 2:2650989-2651011 GCCAAGGGCAGGATCCTGGGAGG + Intergenic
926223980 2:10954602-10954624 GCAGAGTGCAGAAACCTGCTGGG + Intergenic
926684566 2:15689183-15689205 TGAGAGGGCAGAAAGCTGGCAGG - Intergenic
926800513 2:16656092-16656114 GCAGAGGGCAGGAATCTGCCAGG - Intronic
927474788 2:23404739-23404761 ACAGAGGGCAGATTCCTGGCCGG - Intronic
929438175 2:41944652-41944674 GCCGTGAGCAGAAATTTGGCAGG - Intronic
929852220 2:45602861-45602883 GCTGGGGGCAAAAACCTGACTGG + Intronic
930718930 2:54620181-54620203 CCCAAGGGCAGAAGCCTGTCCGG - Intronic
932618271 2:73249934-73249956 GCCGAGCTCACAAACCTGCCTGG + Intronic
934323754 2:91987079-91987101 GGCCAGGGCAGGAACATGGCAGG - Intergenic
935643311 2:105310618-105310640 GCCGAGTGCAGAACTCTTGCAGG + Intronic
937258936 2:120573140-120573162 GCTGAGGTCAGTAACCAGGCAGG - Intergenic
937294627 2:120802373-120802395 GCAGACGGCAGAAGCCTGGGAGG + Intronic
938397696 2:130963364-130963386 GCCCAGGGCAGAGACCCGGCGGG - Intronic
939273675 2:139971562-139971584 GAGGAGGGCATAAACCTGACTGG + Intergenic
941672497 2:168310160-168310182 GGGAAGGGCACAAACCTGGCTGG - Intergenic
942588782 2:177518088-177518110 GTAGAGTGGAGAAACCTGGCAGG - Intronic
943613456 2:190063742-190063764 CCAGAGGGCAGACACCTGGCAGG + Intronic
946371003 2:219281265-219281287 TCCGAGGGAAGAAACAGGGCAGG + Intronic
948924728 2:241088134-241088156 GACAAGGCTAGAAACCTGGCTGG - Exonic
1173982577 20:47236279-47236301 GGAGATGGCAGACACCTGGCAGG - Intronic
1174147212 20:48460220-48460242 GCACAGGGCAGAACCCTGGCTGG + Intergenic
1176015246 20:62927507-62927529 TCCGAGGGCAGGGACCTGGGGGG + Intronic
1176053756 20:63134289-63134311 GCCGAGGGGACAAACCTGGTGGG - Intergenic
1176449650 21:6851228-6851250 GACGACAGCAGAAACCTCGCAGG + Intergenic
1176827822 21:13716252-13716274 GACGACAGCAGAAACCTCGCAGG + Intergenic
1181018267 22:20083855-20083877 GCTGTGGGCAGCAACCAGGCAGG - Intronic
1181494905 22:23282303-23282325 GCCGAGGGCAGACGGCTGCCTGG - Intronic
1182790902 22:32951929-32951951 ACCGATGGCAGACACTTGGCAGG + Intronic
1183151661 22:36042469-36042491 GCCAGAGGCAGCAACCTGGCAGG - Intergenic
1183185242 22:36288153-36288175 GCCCAGGGCGGGAACCTGGCAGG - Intronic
1183566081 22:38616312-38616334 GCCGGGGGCAGGAACCTGACAGG + Intronic
1184088976 22:42282676-42282698 GCTGGGGGCAGAGACCTGGGAGG + Intronic
1184276406 22:43411769-43411791 GCCGAGGGCCGAGGCCTGGCGGG + Intronic
1184344560 22:43905205-43905227 GCAGAGGGCACAAGGCTGGCAGG + Intergenic
1184344568 22:43905240-43905262 GCAGAGGGCACAAGCCTGGCAGG + Intergenic
1184490375 22:44804854-44804876 GGCAAAGGCAGAGACCTGGCGGG + Intronic
1184564651 22:45284911-45284933 GCCGAGGGCCCAGAGCTGGCAGG + Intergenic
1185339915 22:50286641-50286663 GACGTGGGCAGGGACCTGGCAGG - Intronic
949237977 3:1833842-1833864 GCCAAGGGTAGAAACTTGGAGGG - Intergenic
954145057 3:48630403-48630425 GCCAAGACCTGAAACCTGGCTGG + Intronic
954799112 3:53176927-53176949 GCTGAGGGCAGAAGAATGGCTGG - Intronic
956487901 3:69740759-69740781 GCCGAGTGCAGAAGCCCTGCTGG - Intronic
960581154 3:119279900-119279922 CCAGAGGGAAGAAGCCTGGCAGG - Intergenic
961194079 3:124986692-124986714 GCAGAGGGCAGAGGCCTGTCTGG - Intronic
966019180 3:175186646-175186668 GCCAAGTGCAGAAAACTGTCTGG + Intronic
966999934 3:185324565-185324587 GGAGAGGGAAGAAACCAGGCTGG - Intronic
968863870 4:3195204-3195226 TCCTAGGGCAGAAACCTCTCTGG - Intronic
969298271 4:6282072-6282094 GCCGAGGGCACCAAACTGACAGG - Intronic
972484306 4:39527516-39527538 GCTGAGGGCAGAATCCAGGAGGG - Exonic
974072778 4:57140410-57140432 AGCGAGGCCAGAAACCTGACTGG + Intergenic
975393937 4:73853462-73853484 GGTGAGAGCAGAAACCAGGCTGG + Exonic
976125434 4:81829184-81829206 GCTGAGGGCAGTCAGCTGGCAGG + Intronic
985406803 4:189646186-189646208 GACGAAGGCAGGAACGTGGCGGG + Intergenic
985406839 4:189646366-189646388 GACGAAGGCAGGAACGTGGCGGG + Intergenic
991395214 5:66198089-66198111 GGCAAGGGCACAAACCTGGCTGG - Intergenic
993176661 5:84494992-84495014 GTTGAGGGGAGGAACCTGGCGGG - Intergenic
993466227 5:88250214-88250236 ACCGAGACCAGAAGCCTGGCTGG + Intronic
994093129 5:95825975-95825997 GGCCAGGGCGGAAACCTGGCAGG + Intergenic
997213556 5:132092610-132092632 GCCAAGGGCAGAGCCCTGGTTGG - Intergenic
997392791 5:133530819-133530841 CCCCAGTGCAGAGACCTGGCAGG + Intronic
1000915476 5:167075857-167075879 GCAGAGGGCAGAAGCCTTGTAGG - Intergenic
1001032714 5:168274668-168274690 CCCAAGGGCAGAATCCTTGCTGG + Intergenic
1003218418 6:4135751-4135773 GCCGAGAGCAGAGCCCAGGCAGG + Intergenic
1005608073 6:27495542-27495564 GGCGAGTACAGAAGCCTGGCCGG + Intergenic
1006143857 6:31946634-31946656 GCCTAAGGCAGAAACAGGGCAGG + Intronic
1007074412 6:39057637-39057659 GCCCAGGGCAGATACCAGGTCGG - Intronic
1007713965 6:43842974-43842996 GGGGAAGACAGAAACCTGGCCGG - Intergenic
1007734529 6:43972345-43972367 GCAGAGGGCAGGAACCAGGCTGG + Intergenic
1012189928 6:96266409-96266431 AGCGAGGCCTGAAACCTGGCAGG - Intergenic
1014827536 6:126063812-126063834 GCCCAGGGTAGAAATCTGGGAGG + Intergenic
1015213020 6:130719424-130719446 GCCAAGGGCAGAAATATGGCAGG - Intergenic
1016892032 6:149016389-149016411 GCTGAGGACAAAACCCTGGCAGG + Intronic
1017077660 6:150633632-150633654 GCAGAGGGTAGAAGCCTGACTGG + Intronic
1017860911 6:158396248-158396270 GTCGAGGGCAGAACCCAGGTTGG + Intronic
1019350486 7:551944-551966 GCCGAGGGAAGGACCCGGGCGGG - Intronic
1019996267 7:4726326-4726348 GCAGAGGGCAGAATCCAGGAGGG - Intronic
1022749793 7:33213071-33213093 GGGAAGGGCACAAACCTGGCTGG - Intronic
1022817923 7:33931119-33931141 TACTAGGGCAGAAACGTGGCAGG + Intronic
1024045432 7:45582550-45582572 GGCCAGGGCAGGCACCTGGCGGG + Intronic
1024155328 7:46616791-46616813 CAAGAGGGCAGAAACCTCGCTGG + Intergenic
1029476746 7:100789511-100789533 GCAGAGGGCAGAGTCTTGGCTGG + Intronic
1032841201 7:135714734-135714756 TCAGAGGGCAGGAATCTGGCGGG + Intronic
1034481237 7:151321492-151321514 GCAGAGGGCAGAAAAATGTCAGG + Intergenic
1036811000 8:11867746-11867768 GCGGAGGGCAGAGGGCTGGCGGG + Intronic
1037275077 8:17169384-17169406 GCCCAGGGCAGAAAACTCGAGGG + Intronic
1037922244 8:22815663-22815685 GCCGAGGGCCGCACCCGGGCAGG + Intronic
1045994993 8:108352144-108352166 GGCAAGGACACAAACCTGGCTGG + Intronic
1048329746 8:133463611-133463633 GCTGTGGGCAGAAACCCGGCTGG - Intronic
1049476994 8:142801463-142801485 GCCGTGGGAAGAAAAGTGGCTGG - Intergenic
1051694193 9:19750809-19750831 TCAGATGGCAGACACCTGGCCGG - Intronic
1053052924 9:34976637-34976659 GTCCAGGGCAGCAAACTGGCGGG - Exonic
1055058269 9:72043416-72043438 GCCCAGGGGAGAGATCTGGCTGG - Intergenic
1056581631 9:87890916-87890938 GCCAAGGGAATAAACCCGGCTGG + Intergenic
1056640048 9:88362297-88362319 GCTGAGGGCAGGAACATCGCTGG + Intergenic
1057982727 9:99678689-99678711 TCTGAGGGCAGAAACCATGCAGG + Intergenic
1058868136 9:109180254-109180276 GCCAATGGCAGAAACCATGCTGG - Intronic
1059245229 9:112844085-112844107 GCCAAGGGCAGAAAACTAGGTGG + Intronic
1059643727 9:116243257-116243279 GCTGAGAGCAGAAACCGGGCTGG - Intronic
1060176344 9:121499808-121499830 GCCCAGAGCAGAAGCCCGGCCGG - Intergenic
1060744278 9:126119980-126120002 GCAGAGGGGAGCAACGTGGCAGG + Intergenic
1062388494 9:136324719-136324741 ACCGAGGGCAGGCACGTGGCAGG + Intergenic
1203519535 Un_GL000213v1:33289-33311 GACGACAGCAGAAACCTCGCAGG - Intergenic
1186134589 X:6505757-6505779 ACTGAGGGCAGAAACCCAGCCGG + Intergenic
1191839183 X:65498467-65498489 GCCGAGGCAAGAAAGCTTGCTGG - Intronic
1192188504 X:68975095-68975117 TACCAGAGCAGAAACCTGGCAGG - Intergenic
1195273444 X:103255008-103255030 GCCGAGAGCAGAAAGCAAGCGGG - Intronic
1195351555 X:104001233-104001255 GCTGAGTGGGGAAACCTGGCAGG + Intergenic
1198929336 X:141836954-141836976 TCCGAGGGCAGTTCCCTGGCTGG + Intergenic
1200854847 Y:7926409-7926431 CCTGTGGGCAGAAACATGGCAGG + Intergenic
1200868260 Y:8068634-8068656 CCTGAGGGCAGAAACAAGGCAGG - Intergenic
1201190285 Y:11438455-11438477 GGCCAGGGCAGGTACCTGGCAGG - Intergenic
1201367519 Y:13224442-13224464 GCTAAGGACAAAAACCTGGCAGG + Intergenic
1202583338 Y:26403460-26403482 GGCCAGGGCAGGTACCTGGCAGG + Intergenic