ID: 1142187868

View in Genome Browser
Species Human (GRCh38)
Location 16:88703003-88703025
Sequence TGGCGTGCACACCCATGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142187863_1142187868 6 Left 1142187863 16:88702974-88702996 CCCGTCGGTAAACGGATGAAGAG 0: 1
1: 0
2: 0
3: 2
4: 27
Right 1142187868 16:88703003-88703025 TGGCGTGCACACCCATGGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 128
1142187864_1142187868 5 Left 1142187864 16:88702975-88702997 CCGTCGGTAAACGGATGAAGAGA 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1142187868 16:88703003-88703025 TGGCGTGCACACCCATGGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142187868 Original CRISPR TGGCGTGCACACCCATGGAA AGG Intronic
906058317 1:42932571-42932593 TGGCATGCACACACACGGAGGGG - Intronic
906869917 1:49466853-49466875 TGGCATGCACACCCTTGTGATGG + Intronic
908717570 1:67086788-67086810 TGGCTTGAACACCCCTGGAATGG - Intergenic
910865574 1:91785323-91785345 TGGGGGGCACACACAGGGAATGG + Intronic
917941682 1:179928344-179928366 TGGTATCAACACCCATGGAAAGG - Intergenic
922090975 1:222394756-222394778 TGGCATCAACACCCATGCAAAGG - Intergenic
924955682 1:248924300-248924322 TGGCGTGCAAACCCAAGCCAGGG + Intergenic
1063410141 10:5831180-5831202 TGGGGTCCACAACCGTGGAAGGG - Intronic
1065797074 10:29317700-29317722 TGCCATGCACAGCCATGGTAAGG + Intronic
1066737045 10:38489016-38489038 TGGAATGTACACGCATGGAAGGG + Intergenic
1066737583 10:38493239-38493261 TGGAGTGCACTCCAATGGAATGG + Intergenic
1066742424 10:38529666-38529688 TGGCGTGGAAACAAATGGAATGG + Intergenic
1066968722 10:42295886-42295908 TGGAATGCACACGAATGGAATGG - Intergenic
1066969155 10:42299083-42299105 TGGAATGGACACCAATGGAATGG - Intergenic
1068963274 10:62886709-62886731 TGACTTGCAAACCCATGAAATGG + Intronic
1069196243 10:65555012-65555034 TGGTGTGCACACCCCTGGGCTGG - Intergenic
1072836711 10:98722753-98722775 TGGTGTGCATACCCCAGGAAAGG + Intronic
1073157446 10:101358888-101358910 TGGCGTGCATAAACAAGGAAGGG + Intronic
1077232530 11:1464471-1464493 TGGTGAGCCCACCCATGGGATGG + Intergenic
1077314363 11:1910830-1910852 TGGTCAGCACACCCATGAAAGGG - Intergenic
1078019126 11:7640770-7640792 AGGTGTCCACACCCAGGGAAAGG - Intronic
1082700065 11:56417934-56417956 TGGGTTGCACAAGCATGGAAAGG + Exonic
1087120027 11:94564076-94564098 AGGCATGCACACACATTGAAGGG + Intronic
1088008290 11:104969039-104969061 TCCCGTCCACTCCCATGGAAAGG + Exonic
1088017787 11:105081593-105081615 TCCCATCCACACCCATGGAAAGG + Intronic
1089330793 11:117687818-117687840 TGTCCTGCACTCCCATGCAAAGG + Intronic
1089418657 11:118314682-118314704 TGGCTTCCACAACCATGGAGAGG + Intronic
1089638775 11:119833308-119833330 TGGCCTGCACACCCCCGGGATGG - Intergenic
1091165791 11:133474922-133474944 TGACGTGCACACATATGGGAGGG + Intronic
1091228416 11:133972148-133972170 TGGCGTGCCCTCCCCTGCAATGG + Intergenic
1091389880 12:119620-119642 TGGGATCAACACCCATGGAAGGG + Intronic
1091390780 12:124999-125021 TGGAGTCCACCCCCCTGGAAAGG + Intronic
1096204307 12:49707778-49707800 TGGCGTGGACACACCGGGAATGG + Intronic
1100984222 12:100189381-100189403 TGCCCTGCACACCCGTGGCAGGG - Intergenic
1101678808 12:106944316-106944338 TCGCGTGGTCACCCATGGTATGG - Intergenic
1104525384 12:129516098-129516120 TGATGTCCACACACATGGAATGG - Intronic
1105809827 13:23985355-23985377 TGGCGTGGCCACCCCAGGAACGG + Intronic
1107191812 13:37597101-37597123 TGGTGTGTACACCCAGGGGAAGG + Intronic
1108694754 13:52893165-52893187 TGGGGTGCTCACCCATGGAGAGG + Intergenic
1113385851 13:109847053-109847075 TTTCCTGCACACCCATGGGAGGG - Intergenic
1113988532 13:114339380-114339402 TGTCGTGCAAACCCATGCCAGGG + Intergenic
1202875091 14_GL000225v1_random:199682-199704 TGGCATGGACACAAATGGAATGG + Intergenic
1130605472 15:85312710-85312732 TGTAGTGCACACACATGGGAAGG - Intergenic
1132600558 16:770802-770824 AGGGGTGCCCACCCATGGACAGG + Intronic
1133140056 16:3737030-3737052 TGGGGTGCACACACAGGGCAGGG + Intronic
1133269280 16:4602615-4602637 TGGCTTGTACACCCAAGAAAGGG - Intergenic
1135404954 16:22190983-22191005 AGGCGTGCCCAAACATGGAAGGG - Exonic
1137355402 16:47758029-47758051 TGGGGTCCACACCCATGCACTGG + Intergenic
1137390256 16:48075336-48075358 GAGTGTGCACACCCAAGGAAGGG - Intergenic
1137611611 16:49821896-49821918 TGCTGTGCACAACCATGAAAGGG + Intronic
1140704719 16:77616549-77616571 TGGTGCGCACACTCAGGGAAGGG + Intergenic
1142187868 16:88703003-88703025 TGGCGTGCACACCCATGGAAAGG + Intronic
1144514028 17:15902691-15902713 TGGTGTGGACAGCCATGGGATGG - Intergenic
1145328592 17:21851849-21851871 TGGAGTGGAAACCAATGGAATGG + Intergenic
1145341874 17:21961859-21961881 TGGAATGCACACGAATGGAATGG + Intergenic
1145703402 17:26850471-26850493 TGGAGTGGACTCCAATGGAATGG + Intergenic
1145704943 17:26863530-26863552 TGGAGTGGACTCCAATGGAATGG + Intergenic
1145705001 17:26863975-26863997 TGGAGTGCACTCAAATGGAACGG + Intergenic
1151764065 17:76122978-76123000 TGTCGTTCACACTCACGGAAGGG + Intergenic
1203181228 17_KI270729v1_random:58521-58543 TGGAATGCACACGAATGGAATGG + Intergenic
1203201448 17_KI270729v1_random:278945-278967 TGGAGTGGACACGAATGGAATGG + Intergenic
1203211043 17_KI270730v1_random:79646-79668 TGGAGTGGACACGAATGGAATGG + Intergenic
1153493252 18:5671429-5671451 GGGACTACACACCCATGGAACGG + Intergenic
1157877884 18:51290526-51290548 AGGGGATCACACCCATGGAAGGG + Intergenic
1158205482 18:54987994-54988016 TGGCGAGAAAACCAATGGAATGG - Intergenic
1159992747 18:74929188-74929210 TGGCCAGCACACTCAAGGAAGGG - Intronic
924959322 2:19692-19714 TGGCGTGCAAACCCATGCCGGGG - Intergenic
927073453 2:19552853-19552875 TTGGGTGCACACCTATGAAAAGG + Intergenic
928060416 2:28107136-28107158 GGGAGTGCACACCCAAGGGAGGG - Intronic
933210680 2:79565197-79565219 TGGCTTGCAGACCCTTTGAAGGG + Intronic
934193838 2:89823339-89823361 TGGAGTGGACACGAATGGAATGG - Intergenic
937315962 2:120932298-120932320 GGGCGGGCACACCCACGAAATGG - Intronic
939796639 2:146653843-146653865 TGACATTCACAGCCATGGAAGGG - Intergenic
941626002 2:167830895-167830917 TGGCGTCCAGACCCATGGCAAGG - Intergenic
947211027 2:227708944-227708966 TTGTGTGCACAACTATGGAAAGG - Intronic
948137236 2:235645645-235645667 CTGCGTGCTGACCCATGGAAGGG - Intronic
948501785 2:238399745-238399767 CGGTATGCACACCCATGCAAAGG - Exonic
948722310 2:239908797-239908819 TGGTGTGCAACCCCATGGGAAGG - Intronic
1170812262 20:19683821-19683843 TAACATGAACACCCATGGAAAGG + Intronic
1171164846 20:22960603-22960625 TGGCGTGCAGACACCTGGAGTGG - Intergenic
1171921135 20:31099684-31099706 TGGAGTGGACACGAATGGAATGG + Intergenic
1171926528 20:31193403-31193425 TGGAATGGACACCAATGGAATGG + Intergenic
1171929641 20:31217849-31217871 TGGAGTGGACACGAATGGAATGG + Intergenic
1173911077 20:46671379-46671401 TGGGATCCACCCCCATGGAAGGG - Intronic
1174140094 20:48406608-48406630 TTGTGTGCACACCCACAGAATGG - Intergenic
1176748346 21:10671241-10671263 TGGCTTGGACTCCAATGGAATGG - Intergenic
1176749558 21:10680149-10680171 TGGAATGCACACGAATGGAATGG - Intergenic
1176752080 21:10699080-10699102 TGGAGTGGACTCCAATGGAATGG - Intergenic
1180282903 22:10719397-10719419 TGGAATGCACACGAATGGAAAGG - Intergenic
1180283148 22:10721166-10721188 TGGAATGCACTCCAATGGAATGG - Intergenic
1180283649 22:10724735-10724757 TGGAATGCACACGAATGGAATGG - Intergenic
1180531052 22:16350415-16350437 TGGAATGCACACAAATGGAATGG + Intergenic
1181747915 22:24968522-24968544 CAGCATCCACACCCATGGAATGG + Intronic
1184430925 22:44441235-44441257 TGGCGAGCAGGACCATGGAACGG - Intergenic
1203318592 22_KI270737v1_random:35382-35404 TGGAATGCACACAAATGGAATGG - Intergenic
962474082 3:135740525-135740547 TGGAGTGCACACACATGAGATGG - Intergenic
969484849 4:7466571-7466593 TGCAGTGGAAACCCATGGAAAGG + Intronic
978714518 4:111825371-111825393 TGGCTTGCACTCCCATTGATGGG - Intergenic
985468651 5:22426-22448 TGGCGTGCAAACCCATGCCAGGG - Intergenic
986200240 5:5572824-5572846 TTGAGAGCACACCCCTGGAAAGG - Intergenic
986771603 5:10978810-10978832 TGGTGTTCACACTCATGGCAAGG + Intronic
987825526 5:23026106-23026128 TGGCCTGCACACACACTGAATGG - Intergenic
992038904 5:72809019-72809041 AAGCGTGCACTCCCCTGGAAAGG - Intergenic
996088832 5:119330706-119330728 TGGAGTACACACACACGGAAGGG + Intronic
999134125 5:149306476-149306498 TGGTGGGCACACCCATGCTAAGG - Intronic
1002085792 5:176774662-176774684 TGGCGTGCCCACCCCTGGTGAGG + Intergenic
1002593098 5:180304606-180304628 GGGAGTGCACACACTTGGAAAGG - Intronic
1003535984 6:6975848-6975870 TGGCGTTCTCTCCCATGGGAGGG + Intergenic
1006483875 6:34321670-34321692 TGACTTGCATACCCATGGAATGG - Intronic
1006661307 6:35647783-35647805 TGGAGTTCAGACCCATCGAAAGG + Intronic
1010783676 6:79974735-79974757 TCGCCTGCACATCCATGGCAGGG - Intergenic
1035058650 7:156053053-156053075 TGGGGTGGACACTCATGGATGGG + Intergenic
1035058748 7:156053536-156053558 TGGGGTGGACACTCATGGATAGG + Intergenic
1035058769 7:156053630-156053652 TGGAGTGGACACTCATGGATGGG + Intergenic
1035058779 7:156053668-156053690 TGGGGTGGACACTCATGGATGGG + Intergenic
1035058789 7:156053706-156053728 TGGGGTGGACACTCATGGATGGG + Intergenic
1035271130 7:157720570-157720592 CCGCGTGCACACCCATGCATCGG - Intronic
1035413711 7:158666949-158666971 TGGCGTGCACACCTCAGTAATGG - Intronic
1035414755 7:158673569-158673591 TGGGGTGCACACCTGTGTAAGGG - Intronic
1035696997 8:1605613-1605635 TGGAGGGGACAACCATGGAAAGG - Intronic
1041207437 8:55512778-55512800 TGGCGTGCCCATCCATGGAGGGG - Intronic
1057314077 9:93958036-93958058 GGGGGTGCACACCTGTGGAATGG - Intergenic
1057430980 9:94993814-94993836 TGGCATGAACATGCATGGAAGGG + Intronic
1203724574 Un_GL000216v2:39353-39375 TGGACTGCACACAAATGGAATGG - Intergenic
1203729179 Un_GL000216v2:75532-75554 TGGCATGGACACAAATGGAATGG - Intergenic
1203350920 Un_KI270442v1:80699-80721 TGGCATGGACACGAATGGAATGG + Intergenic
1203350960 Un_KI270442v1:81054-81076 TGGAATGCACACGAATGGAATGG + Intergenic
1190690260 X:52907867-52907889 AGACGTGCACCCCCATGGGATGG + Exonic
1190695723 X:52947925-52947947 AGACGTGCACCCCCATGGGATGG - Exonic
1195213153 X:102669843-102669865 AGCCGTCCACTCCCATGGAAAGG - Intergenic
1196158652 X:112458347-112458369 TGGCGTGTCCACCCCTGCAATGG + Intergenic
1196996004 X:121384623-121384645 TGGGGTGTATACCCAAGGAAAGG + Intergenic
1198816177 X:140593290-140593312 AGGAGGGCACACCTATGGAATGG - Intergenic
1201130195 Y:10946573-10946595 TGGAGTGCACAGGAATGGAATGG - Intergenic
1201211253 Y:11682700-11682722 TGGAATGCAAACTCATGGAACGG + Intergenic
1201212943 Y:11697235-11697257 TGGAGTGGACACGAATGGAATGG + Intergenic