ID: 1142187899

View in Genome Browser
Species Human (GRCh38)
Location 16:88703158-88703180
Sequence CCCAGTGACCAGAAAGCAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 332}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142187894_1142187899 24 Left 1142187894 16:88703111-88703133 CCCGTGTCGTGGGGGTCCACTCA 0: 1
1: 0
2: 1
3: 4
4: 60
Right 1142187899 16:88703158-88703180 CCCAGTGACCAGAAAGCAGACGG 0: 1
1: 0
2: 1
3: 34
4: 332
1142187897_1142187899 -9 Left 1142187897 16:88703144-88703166 CCAGCAGAGAGAAACCCAGTGAC 0: 1
1: 0
2: 0
3: 22
4: 341
Right 1142187899 16:88703158-88703180 CCCAGTGACCAGAAAGCAGACGG 0: 1
1: 0
2: 1
3: 34
4: 332
1142187893_1142187899 27 Left 1142187893 16:88703108-88703130 CCACCCGTGTCGTGGGGGTCCAC 0: 1
1: 0
2: 1
3: 2
4: 39
Right 1142187899 16:88703158-88703180 CCCAGTGACCAGAAAGCAGACGG 0: 1
1: 0
2: 1
3: 34
4: 332
1142187892_1142187899 28 Left 1142187892 16:88703107-88703129 CCCACCCGTGTCGTGGGGGTCCA 0: 1
1: 0
2: 0
3: 0
4: 33
Right 1142187899 16:88703158-88703180 CCCAGTGACCAGAAAGCAGACGG 0: 1
1: 0
2: 1
3: 34
4: 332
1142187896_1142187899 8 Left 1142187896 16:88703127-88703149 CCACTCACGCTCAACGTCCAGCA 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1142187899 16:88703158-88703180 CCCAGTGACCAGAAAGCAGACGG 0: 1
1: 0
2: 1
3: 34
4: 332
1142187895_1142187899 23 Left 1142187895 16:88703112-88703134 CCGTGTCGTGGGGGTCCACTCAC 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1142187899 16:88703158-88703180 CCCAGTGACCAGAAAGCAGACGG 0: 1
1: 0
2: 1
3: 34
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142187899 Original CRISPR CCCAGTGACCAGAAAGCAGA CGG Intronic
902278582 1:15357886-15357908 CTCAGAGACCAGAAATCACAAGG + Intronic
903682064 1:25103703-25103725 CCCCGTGAGCAGAGAGCAGCTGG - Intergenic
904355281 1:29934538-29934560 CCCAGGCCCCAGGAAGCAGAGGG - Intergenic
905383641 1:37583086-37583108 CCCAGTGATCAGAATTCAAAAGG + Intronic
906164918 1:43678992-43679014 CACTGTCACCAGAATGCAGATGG + Intronic
906496085 1:46304912-46304934 CCAAGTGACCAGAGAACAGACGG - Intronic
906538761 1:46568770-46568792 CACAGTGACCACCAAGAAGAAGG + Intronic
906650586 1:47509666-47509688 CCCAGTGCCCAGCACACAGACGG + Intergenic
907321685 1:53606613-53606635 CCCAGAGACCAGCAGGGAGATGG + Intronic
908392856 1:63699214-63699236 CCAAATGCCCAGAAAGCAGTAGG + Intergenic
908601491 1:65744611-65744633 CCCAGTGAGACCAAAGCAGAAGG - Intergenic
908851795 1:68384339-68384361 GCCAGTTCCCAGAAAGCTGATGG + Intergenic
909412768 1:75374091-75374113 GCAAGTGACCTGAATGCAGAAGG + Intronic
911808501 1:102243091-102243113 CCCTGTGAGGAGAAAACAGAAGG + Intergenic
912173828 1:107134092-107134114 CATTGTGACCAGAAAGCAGGTGG - Intergenic
912916198 1:113817087-113817109 CCGAGTGGCAAGAAAGAAGATGG + Intronic
915771166 1:158426294-158426316 CACAGTGACCATAAAGCAGTAGG + Intergenic
915850289 1:159314398-159314420 TCAAGAGACCAGAAAGCATATGG + Exonic
918017130 1:180646622-180646644 CCCAATGATGAGACAGCAGAGGG - Intronic
918234781 1:182570188-182570210 CTCTGTGAACAGAAAGCAGAGGG - Intergenic
919880294 1:201896600-201896622 CCCAGTGCCCAGCAGGCACAGGG + Exonic
923082169 1:230668385-230668407 CACAGGGACCAGACAGCAGCAGG - Intronic
923098239 1:230792531-230792553 CCCAGTGAACCTAGAGCAGAGGG + Intronic
924314019 1:242776932-242776954 ACCTGTGACCTGAGAGCAGAGGG + Intergenic
1062907418 10:1188079-1188101 CCCACTGACCAGGAACCAGGTGG + Intronic
1063380938 10:5585360-5585382 CCCACGGACCAGCCAGCAGAGGG - Intergenic
1065132187 10:22633483-22633505 CCCAGCTACCAGTAAGGAGAGGG + Intronic
1065240877 10:23703012-23703034 CCGAGGGACCAGAATACAGAGGG - Intronic
1069914067 10:71776390-71776412 GCCAGAGAACAGAAAGCAGGTGG - Intronic
1070590567 10:77797743-77797765 CACAGGGACCAGGAGGCAGAAGG + Intronic
1071401883 10:85280777-85280799 CCCAGTGAGATCAAAGCAGAAGG - Intergenic
1071439427 10:85677316-85677338 CACAGTGGCCAGCAAGCAGTGGG + Intronic
1072876074 10:99174859-99174881 CCCAGTGACATCAACGCAGAAGG + Intronic
1073759728 10:106616515-106616537 CCCAGCACCCAGAAAGGAGATGG + Intronic
1075030560 10:119021915-119021937 CTTAGTGACCAGAAGGCAGGTGG - Intergenic
1075962869 10:126584502-126584524 CCCAGTCCCCAGAGTGCAGATGG - Intronic
1076229433 10:128807921-128807943 CCCAGTGTCCAGCAACCAGGAGG + Intergenic
1076294513 10:129374210-129374232 CAGTGTGAACAGAAAGCAGAGGG - Intergenic
1076642539 10:131928576-131928598 CCCAATGTCCAGAAAGCAGCGGG - Intronic
1076812932 10:132898581-132898603 CCCTGAGAACAGCAAGCAGAGGG - Intronic
1078455149 11:11469195-11469217 CACAGAGGCAAGAAAGCAGACGG - Intronic
1079590488 11:22177310-22177332 CTCAGTTGCCAGAAAGCTGAGGG + Intergenic
1080316196 11:30951965-30951987 CCCAGTAATCAGCAAGCATATGG - Intronic
1082739233 11:56892037-56892059 CCCAGAAATCAGAGAGCAGAGGG + Intergenic
1083553000 11:63604949-63604971 CCCAGCACCCAGAAACCAGAGGG - Intronic
1083844274 11:65321804-65321826 CCCAGGGACCTGAAGGAAGAAGG - Exonic
1085390980 11:76182065-76182087 CCCAGTACCCAGAAAGGAGTAGG + Intergenic
1085787702 11:79469591-79469613 CCCAGTGAAAAGAAAGTACATGG + Intergenic
1087639590 11:100742093-100742115 CACAGTGAGCAAAAAGCAGAAGG - Intronic
1088020783 11:105116019-105116041 CAGAGTGATCAGACAGCAGAAGG + Intergenic
1089362186 11:117898252-117898274 CCAAGTTACCAGAAACCACATGG + Intergenic
1090885493 11:130872692-130872714 CCCAGTGGAAAGGAAGCAGAGGG + Intergenic
1092906328 12:13103164-13103186 CCCTGGGAACAGAAAGGAGAAGG + Intronic
1094296737 12:28915176-28915198 CCCAGTGATCTGGGAGCAGAAGG + Intergenic
1094342200 12:29425102-29425124 CCCTGTGAACAGACAGCAAATGG + Intronic
1096626854 12:52901123-52901145 TCCAGTGTCCAGATAGGAGAAGG + Intronic
1099528067 12:83740724-83740746 CCCAGTGAGACCAAAGCAGAAGG + Intergenic
1100109501 12:91221823-91221845 ACCACTGAACAGAAGGCAGAAGG - Intergenic
1102302324 12:111779845-111779867 CCCAGTGCCTGGAAAGCAGAGGG + Intronic
1102463746 12:113115823-113115845 CCCTGGGACCCCAAAGCAGATGG + Intronic
1102774697 12:115508327-115508349 CTCAGTGACGAGAGGGCAGAGGG - Intergenic
1104566259 12:129887152-129887174 CCCAGTGATCAGTAACCAGGGGG + Intronic
1104637401 12:130446944-130446966 CCCTGAGGCCAGAAAGCCGAGGG - Intronic
1104870777 12:131994007-131994029 CCAAGTGATCAGAAGGCAGAAGG + Intronic
1105284961 13:18996109-18996131 CCCGGAGGCCAGAATGCAGAAGG + Intergenic
1105284969 13:18996151-18996173 GCAAATGACAAGAAAGCAGAAGG + Intergenic
1105285071 13:18996737-18996759 CCACATGGCCAGAAAGCAGAAGG + Intergenic
1105285075 13:18996759-18996781 GCCAGAGGCCAGAAGGCAGAAGG + Intergenic
1105285080 13:18996790-18996812 ACCAGAGGCCAGAATGCAGAAGG + Intergenic
1108434823 13:50391675-50391697 CCTAGTGTCCAGAAATCAGCAGG - Intronic
1108774781 13:53752251-53752273 CCCAGTGAGGAGAAAGCCAATGG - Intergenic
1110242247 13:73282298-73282320 GCCAGTGAGAAGAAGGCAGAAGG - Intergenic
1110337177 13:74346341-74346363 CCCAGTGAGACGAACGCAGAAGG + Intergenic
1110378430 13:74821046-74821068 CCCAAGGCACAGAAAGCAGAGGG + Intergenic
1110474942 13:75902856-75902878 CTCAGTCACCAAAAAGCAGCAGG - Intergenic
1112642051 13:101286400-101286422 CCCAGAGAGCAGGAAGAAGAAGG - Intronic
1113420206 13:110165228-110165250 CCCAGAGCCCAGAATGCAGTGGG - Intronic
1113864641 13:113512906-113512928 CCCAGGGGCCAGAATGTAGATGG + Intronic
1114248771 14:20939186-20939208 CACAATGACCAGAAAGCTAAAGG - Intergenic
1114268808 14:21089113-21089135 CTCTGTGTCCAGGAAGCAGAGGG - Exonic
1115648720 14:35387904-35387926 TCCAGTGACCAGCAAGCTGCTGG + Intergenic
1115780873 14:36766623-36766645 CCCAGAGGCCAGAAAGCACGGGG - Intronic
1116009364 14:39332815-39332837 CCCAGTGAGGCCAAAGCAGAAGG - Intronic
1117442571 14:55773709-55773731 CACAGTGGTCTGAAAGCAGAAGG - Intergenic
1119152351 14:72373195-72373217 GCAAGTGACCAGAAAGCTAAAGG + Intronic
1119859003 14:77923341-77923363 CCCTGAGGCCAGAAAGCACACGG + Intronic
1121813278 14:96910327-96910349 ACCAGTGCCCAGAAGGCACATGG - Intronic
1122046921 14:99030395-99030417 CACAGTGACCAGAATCCTGAAGG + Intergenic
1122094822 14:99363129-99363151 CCCAGAGCCCAGAGAGCAGCTGG + Intergenic
1122241302 14:100369573-100369595 CCCAGTGCCCAGAACACAGGAGG + Intronic
1122890044 14:104728001-104728023 GCCAGTGTCCAGCCAGCAGACGG + Intronic
1123114028 14:105885788-105885810 CCCAGAGACCATGAAACAGATGG - Intergenic
1124147315 15:27139800-27139822 GCCAGTGACCAGAAAGATCAAGG + Intronic
1124256258 15:28145189-28145211 CCAGGTGACCAGGCAGCAGAAGG + Intronic
1124372367 15:29110977-29110999 CCGAGTGGCCAGGAAGCTGAGGG + Intronic
1125186288 15:36934496-36934518 ATCAGGGATCAGAAAGCAGAAGG - Intronic
1126962938 15:54018210-54018232 CCCAAAGCCCAGTAAGCAGATGG - Intronic
1127828482 15:62727582-62727604 GCGAGTGAACAGAAAGCTGAGGG + Intronic
1127945626 15:63748404-63748426 TCCACTCACCTGAAAGCAGAGGG + Intronic
1128621081 15:69150473-69150495 TCCAGTGACCAGAGATGAGATGG - Intergenic
1128737397 15:70060923-70060945 CCCACAGGCCAGAAGGCAGACGG - Intronic
1129708168 15:77806467-77806489 CCCAGGGACCTGAAGGCAGGTGG - Intronic
1129800320 15:78408954-78408976 CACAGAGACCAGAAAGGGGAAGG + Intergenic
1129921421 15:79322386-79322408 CTCAGAGACCAGTAATCAGAAGG + Exonic
1131865272 15:96702142-96702164 AACAGTGACCCTAAAGCAGAAGG - Intergenic
1133051359 16:3119141-3119163 CTCAGAGACCAGAAAGCGCAAGG - Intronic
1133594998 16:7282528-7282550 ACCAGAGAACAGAGAGCAGAAGG - Intronic
1134057532 16:11180016-11180038 ACCAGTGACCAGAGAGGTGAGGG - Exonic
1135323770 16:21513196-21513218 AGCAGTGACCAGAGAGCAGAGGG - Intergenic
1135537096 16:23302655-23302677 CCCAGGGTGCAGAAGGCAGACGG + Intronic
1135909193 16:26543820-26543842 ACCAGTGACAAGATAGCAAAGGG + Intergenic
1136287959 16:29255070-29255092 CCCACAGCCCTGAAAGCAGAGGG + Intergenic
1136335253 16:29606461-29606483 AGCAGTGACCAGAGAGCAGAGGG - Intergenic
1141829352 16:86501080-86501102 CCCAGGGGCCACAGAGCAGATGG + Intergenic
1142035978 16:87862303-87862325 AGCAGTGACCAGAGAGCAGAGGG - Intronic
1142093616 16:88227787-88227809 CCCACAGCCCTGAAAGCAGAGGG + Intergenic
1142187899 16:88703158-88703180 CCCAGTGACCAGAAAGCAGACGG + Intronic
1143297314 17:5880970-5880992 ACCAGGGAGCAGAAAGAAGACGG - Intronic
1143322882 17:6079509-6079531 CCCAGAGAAGAGAAGGCAGAAGG - Intronic
1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG + Intronic
1145992956 17:29090178-29090200 CACAGTGACCAGAAGGCAAGGGG + Intronic
1146706140 17:35002053-35002075 GCCAGTACCAAGAAAGCAGAAGG + Exonic
1147165640 17:38591770-38591792 GCCAGGCACCAGAAAGCAAATGG - Intronic
1147505967 17:41017909-41017931 CCCAGAGACCTGACTGCAGACGG - Intronic
1147905048 17:43817128-43817150 CCAGGTGACCAGAACACAGATGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151181183 17:72329792-72329814 CACAGTGGCCAGAAGGAAGATGG - Intergenic
1151464237 17:74274311-74274333 CCCAGAGACCCAGAAGCAGAAGG + Intronic
1151823731 17:76512150-76512172 CCCAGGGAACAGAAAGCCCAGGG - Intergenic
1151925026 17:77189243-77189265 CACAGAGAACAGAGAGCAGATGG + Intronic
1152892682 17:82891393-82891415 CACAGTGACCAGCATGCGGACGG + Intronic
1153286357 18:3458477-3458499 CCCAGTGAGCAGGAAGCTGGGGG + Intronic
1153894746 18:9548501-9548523 CCTAATGAAGAGAAAGCAGAAGG + Intronic
1154064880 18:11097503-11097525 CCCTCTGACCAGAAAACACAGGG + Intronic
1155489845 18:26389742-26389764 CCCAGTGACCAGAGGGTAGTGGG + Intronic
1156339624 18:36199787-36199809 CCCAGGGCCCAGAGAGCAGTGGG + Exonic
1156894080 18:42224575-42224597 CCCAAAGACCAGTCAGCAGAGGG - Intergenic
1157200274 18:45653720-45653742 CCCAGTCAGCAGGAATCAGAAGG + Intronic
1158155075 18:54416696-54416718 CCCAGTGTCTGGAATGCAGAAGG - Intergenic
1158397565 18:57091119-57091141 CCTAGTGAACAGTCAGCAGAAGG + Intergenic
1160766635 19:811651-811673 CCCAGTTTCCAGAGAGCAGGCGG + Exonic
1161777364 19:6270875-6270897 CCCAGTGAGCAGCACACAGACGG + Intronic
1161840891 19:6679641-6679663 CCCAAAGATCAGAAAGTAGAGGG - Intronic
1162831315 19:13286474-13286496 CCCAGTGATGTGAGAGCAGAGGG + Intronic
1163754805 19:19100429-19100451 CCCAGAGAAGAGAAAGGAGATGG - Intronic
1164243474 19:23410187-23410209 CCCTGGGAACACAAAGCAGAAGG + Intergenic
1164433447 19:28208011-28208033 CCCAGTGAGTAAAATGCAGAGGG - Intergenic
1164971811 19:32539299-32539321 CCCAGTGGACAGTAACCAGAAGG + Intergenic
1166315314 19:41986034-41986056 CCCAGTGACCCCCAGGCAGAGGG - Intronic
1168411768 19:56144708-56144730 CCCCTTGACCACAAGGCAGAGGG - Intronic
925595515 2:5552054-5552076 ACCAGTGACCAGATAGCTGTGGG - Intergenic
926131524 2:10305760-10305782 CCCTGTGGCCAGAAAGGGGACGG - Intronic
926194959 2:10757806-10757828 TCCAGTGTCCATAAAACAGACGG - Intronic
927200088 2:20572769-20572791 CCCAGTGACCCCCAAACAGATGG - Intronic
927209022 2:20627382-20627404 TGCATTGACCAGAAATCAGAGGG + Intronic
927255375 2:21036533-21036555 CCCAGTTAACAGAGAGGAGAGGG + Intronic
928726457 2:34179416-34179438 CCAAGTGAATAGAAAGGAGAGGG + Intergenic
929420877 2:41788458-41788480 TGCAGTGTCCAGAAAGAAGAGGG - Intergenic
930034674 2:47078043-47078065 CCCATTGCCCAGAAAGGACATGG - Intronic
930191341 2:48463244-48463266 CCCAGTGATCAGGAGGCAGAGGG + Intronic
931856084 2:66303113-66303135 CCCAGTCACCAAGACGCAGAGGG + Intergenic
932981168 2:76669066-76669088 CCAAGTAACCATAAAACAGATGG - Intergenic
933280527 2:80328176-80328198 CCCAGCAATCAGAGAGCAGATGG + Intronic
935010937 2:99135406-99135428 CCCAGTGAGATGAATGCAGAAGG - Intronic
935120521 2:100180000-100180022 CCCTCTAACCAGAAGGCAGAGGG - Intergenic
935319078 2:101867777-101867799 CCCAGGTACCAAAAAGCAGAAGG - Intronic
936081692 2:109436872-109436894 CCCTGTGGAGAGAAAGCAGAAGG - Exonic
937722255 2:125115112-125115134 CCTAGAGACCAGAAGGCAGTTGG + Intergenic
938232741 2:129675578-129675600 CCCAGTGAACAGAGAGAGGAAGG - Intergenic
938752818 2:134350632-134350654 CCAAGTAAACAGAAAGCAGCAGG - Intronic
940865634 2:158815158-158815180 CCCAGTGAAGAGAAGGCTGAGGG - Intronic
940888641 2:159013779-159013801 ACCAGGTACCAGAAAGTAGATGG + Intronic
941885915 2:170527211-170527233 TCCAGTGAGAAGAAGGCAGAGGG + Intronic
942093251 2:172514291-172514313 CCAAGCGAGCAGTAAGCAGAAGG + Intergenic
943189907 2:184663186-184663208 CCCAGGCACCAGAGAGCACAGGG - Intronic
943349984 2:186785692-186785714 CCCAGTGAGGAGAAATCAAATGG - Intergenic
943981344 2:194555131-194555153 CCCAGTGAAAAGGAAGGAGATGG + Intergenic
944938011 2:204589889-204589911 CCCAGTGAGCAGATGGGAGATGG + Intronic
945620322 2:212127774-212127796 CCCCGTGACCAGAAAGGCAAAGG + Intronic
947018589 2:225648765-225648787 CCTAGGGACCAGGAAGCACAGGG + Intronic
948586747 2:239024551-239024573 CACAGCCACCAGAAAACAGATGG - Intergenic
1168846961 20:951904-951926 GGCACTGACCAGGAAGCAGAAGG - Intergenic
1169080480 20:2795367-2795389 CACAGTGACCTCAAAGCAGTTGG + Exonic
1169793138 20:9432788-9432810 ACCAGTGACCACAGGGCAGAAGG + Intronic
1170318840 20:15071439-15071461 CTCAGTGACTGGAAAGCAGAGGG + Intronic
1171089493 20:22270554-22270576 CCCAGTGAAGTGAAAGAAGAGGG - Intergenic
1171406874 20:24917660-24917682 TCCTATCACCAGAAAGCAGATGG - Intergenic
1172765449 20:37348329-37348351 CCCAGGAACCAGAGAGGAGATGG + Intronic
1173977199 20:47195929-47195951 TCCAGTGACAAGATATCAGAAGG + Intergenic
1174862325 20:54102568-54102590 GACAGGGACCAGCAAGCAGAGGG - Intergenic
1174913676 20:54633219-54633241 CCCAGGGCCCAGAAAGCATAGGG + Intronic
1175400995 20:58699760-58699782 CCCACTGCCCAGGAACCAGAGGG + Intronic
1175440466 20:58987376-58987398 CCCAGTGAGGAGGGAGCAGATGG - Intronic
1176934677 21:14852882-14852904 CCTAGAAACCAGAAACCAGAGGG + Intergenic
1177136279 21:17308346-17308368 CCCAGTGAGATCAAAGCAGAAGG + Intergenic
1177856341 21:26404602-26404624 CCCAGTGAGCAGAGAGCAGCAGG - Intergenic
1179149237 21:38795991-38796013 CACAGTGAACAGGAAGCAGGGGG + Intergenic
1179382472 21:40912094-40912116 CCCAGTGGCAAGCAGGCAGATGG - Intergenic
1179784190 21:43720274-43720296 CCCAGTGACCAGGCCGCAGGTGG - Intronic
1180004325 21:45013125-45013147 CCCAGGGAGGTGAAAGCAGATGG + Intergenic
1180005927 21:45020516-45020538 AGCAGTGACCAGAAGGCACATGG + Intergenic
1180959022 22:19754390-19754412 CCCTGGGACCAGGGAGCAGATGG + Intergenic
1181541251 22:23574383-23574405 GACAGTCACCAGAAAGGAGAGGG - Intronic
1181566599 22:23742582-23742604 CCCACTGCTCAGAAACCAGACGG + Exonic
1182567489 22:31211146-31211168 CCAAATGACCAGAAAGAGGATGG - Intergenic
1182656960 22:31898290-31898312 CCCAGAGCCCAGAACCCAGAGGG + Intronic
1182990094 22:34759360-34759382 CCCAGAGACTAGGAAGCAGAGGG + Intergenic
1183185202 22:36287904-36287926 CCCAGAGCCCAGAAGGCTGAAGG + Intronic
1183187350 22:36299678-36299700 CCCAGGGAGCAGATAGCAGCCGG - Intronic
1183218747 22:36498195-36498217 CCCAGTGACCAGAGATAAAATGG - Intronic
1183686677 22:39365040-39365062 CCAGGTCACCAGCAAGCAGAGGG - Intronic
1183985637 22:41568771-41568793 CAGAGAGACCAGAGAGCAGAAGG - Intronic
1185095893 22:48806009-48806031 CCCAGTGACCTGAAAGAGGAGGG + Intronic
950659210 3:14456276-14456298 CGCTGTGACCAGCAAGAAGAGGG + Intronic
950714333 3:14837033-14837055 CACAGTGACCAGACTGCAGCAGG + Intronic
951350953 3:21606250-21606272 CCCATTGTCCTGAAGGCAGAAGG - Intronic
951577461 3:24128321-24128343 CCCAGGGACTTGAAGGCAGAGGG + Intronic
952407788 3:33019971-33019993 GCCAAAGATCAGAAAGCAGAAGG + Intronic
953357936 3:42270206-42270228 CCCACTTACCAGAAGGCAGGAGG + Intergenic
953392627 3:42542583-42542605 GCTAGTGACAAGAAAGCAGAAGG + Intergenic
953570012 3:44063841-44063863 CCCAGTGATGAGTAACCAGAGGG + Intergenic
954144336 3:48626897-48626919 CACAGTGTCCACAAAGGAGAGGG + Exonic
956106811 3:65828089-65828111 TCCAATGCCAAGAAAGCAGATGG - Intronic
957245658 3:77712612-77712634 ACCAGGGACCAGACTGCAGAGGG + Intergenic
957731685 3:84147176-84147198 GACAGTGACCATAAAGGAGAGGG - Intergenic
957890725 3:86353658-86353680 ACCAGTAACAAGAAAGGAGATGG - Intergenic
958722699 3:97864475-97864497 CCCAGTGACCATCATGAAGACGG + Exonic
959370983 3:105525521-105525543 TCAAGTTATCAGAAAGCAGAGGG - Intronic
960705140 3:120474475-120474497 CCCATAGACTGGAAAGCAGAAGG - Intergenic
961151355 3:124641081-124641103 CCAAGTGACCATAAAGCACCAGG - Intronic
961445461 3:126978955-126978977 CCCAGTGACCAGGGATCTGAGGG + Intergenic
962156744 3:132956449-132956471 CCCAGTGACACCAATGCAGAAGG + Intergenic
962894828 3:139704768-139704790 CCCAGTGGCCAGGATGAAGAGGG + Intergenic
962949972 3:140209341-140209363 CCCACTGTCCTGAAAGCATAAGG - Intronic
964956943 3:162370965-162370987 CTCTGTGACCACAAAGAAGAAGG - Intergenic
969061484 4:4438743-4438765 CACAGTGACCAGCATGCAGGGGG + Intronic
969196684 4:5568863-5568885 CCCAGTGACTTGAGAGCAGTTGG - Intronic
969600411 4:8172737-8172759 CCCAGTGCACACAAACCAGATGG + Intergenic
969995132 4:11304235-11304257 CCCAGTGACCATCACGCAGGTGG - Intergenic
970046851 4:11863839-11863861 TCCAGAGACCAGAAAACAGATGG + Intergenic
971995076 4:33954995-33955017 CCCAGTGATCTGAATGCAGAAGG - Intergenic
972421418 4:38890874-38890896 CCCAAAGATCAGAAAGCAGCAGG + Intronic
973565206 4:52179165-52179187 CACAGAGGCCAGAAAGCAGTGGG + Intergenic
973872686 4:55182072-55182094 ACCCCTGACCAGAAAGGAGATGG - Intergenic
975307505 4:72866547-72866569 CCCAGTGACACCAATGCAGAAGG + Intergenic
975625224 4:76338900-76338922 CCCAATGATGAGACAGCAGAAGG + Intronic
977671304 4:99698794-99698816 CCCAGTGAGACCAAAGCAGAAGG + Intergenic
979565588 4:122151333-122151355 ACCAGTGTCCAGGTAGCAGAAGG + Intergenic
982794640 4:159630113-159630135 CCCAGTGATATCAAAGCAGAAGG - Intergenic
983123144 4:163913732-163913754 ACCAGTGTCCAGAAAGCAGTAGG - Intronic
983976642 4:173942859-173942881 CCAAGGGTGCAGAAAGCAGAGGG + Intergenic
984062009 4:175001468-175001490 CCCAGAGAATAGAAAGGAGAAGG - Intergenic
984120051 4:175730913-175730935 CCAAGAGACCAGAAAACTGATGG - Intronic
984139243 4:175982089-175982111 CCCACTAACAAGAAAACAGAGGG - Intronic
984381759 4:179002052-179002074 ACCAGGGAACAGAAAGCAAAAGG - Intergenic
988180923 5:27792061-27792083 CCCTGAAAACAGAAAGCAGACGG + Intergenic
988929835 5:36027189-36027211 CAGAGTGTCCAGAAAACAGATGG + Intergenic
990174503 5:53092058-53092080 CCCAGTCACTAGGATGCAGATGG + Exonic
991641410 5:68757998-68758020 CCCAGGGACCAGGAAGCACAAGG + Intergenic
992013780 5:72556458-72556480 CCCAAATCCCAGAAAGCAGAAGG - Intergenic
992839113 5:80669272-80669294 TCTAGTGACCAAAAAGAAGAGGG - Intronic
996029305 5:118687169-118687191 TGCAGTGACCTGAGAGCAGAGGG + Intergenic
998870176 5:146544031-146544053 CCCAGTGACCCTGATGCAGAGGG + Intergenic
999832404 5:155333084-155333106 CCCAGTATCCTGAAAGCAGGAGG + Intergenic
999966978 5:156820367-156820389 CCCTGAGACAAGCAAGCAGATGG - Intergenic
1001356229 5:171026206-171026228 CCTAGTGAACAGCAAGCACATGG - Intronic
1003011075 6:2428092-2428114 CCCAGAATCCAGGAAGCAGATGG - Intergenic
1003352610 6:5332209-5332231 CCCAGTGTGCAGCAAGCAGTGGG + Intronic
1003669064 6:8139123-8139145 CAAAGTGACCAGGAAGGAGAGGG - Intergenic
1004053834 6:12114272-12114294 CCCAGTGACCACCAAGCCCAGGG + Intronic
1004206604 6:13597297-13597319 CCCAGTGTACAGAAAGCATAGGG + Intronic
1004917687 6:20347126-20347148 CCCACAGACAGGAAAGCAGAAGG + Intergenic
1006389371 6:33749534-33749556 CCCACTGACTAGGAAGCAGCAGG - Intergenic
1006389379 6:33749566-33749588 CCCACTGACTAGGAAGCAGCAGG + Intergenic
1010122217 6:72389492-72389514 TCCAGTGACCAAAAATGAGAGGG + Intronic
1011093961 6:83637596-83637618 CTCAGTGATCTGAGAGCAGAAGG - Intronic
1013401393 6:109800213-109800235 CCCAGTGATTGGAAAGCAGCTGG - Intronic
1013772305 6:113641515-113641537 CCCAGTGATCAGAAAGCTGAGGG - Intergenic
1014637960 6:123872380-123872402 CCCAGTGACTAAAATGCACACGG - Intronic
1014661594 6:124179590-124179612 GGCAGTGAGCAGACAGCAGAGGG + Intronic
1014697995 6:124648136-124648158 TCCACTGAAAAGAAAGCAGAAGG + Intronic
1015025972 6:128532857-128532879 CCCTGTGAGGACAAAGCAGAAGG + Intergenic
1016225249 6:141727047-141727069 CCCAGTAACTAGAAAACAGAAGG - Intergenic
1016305991 6:142684059-142684081 CCCTGTGACCAGAAAGTTCATGG - Intergenic
1016420941 6:143882521-143882543 CCTAGTTAACAGGAAGCAGATGG - Intronic
1016524028 6:144979357-144979379 CCCTGTGAACAAAAAGTAGAAGG + Intergenic
1018188217 6:161286441-161286463 CCCAGTGCCCAGGAAGGAGCAGG + Intergenic
1019429421 7:991869-991891 CCCACAGACCAGGAAGGAGAAGG - Intergenic
1019675156 7:2307107-2307129 CCCAGTCAACAGAAAACAGCAGG + Intronic
1020070450 7:5223700-5223722 CCCAGTGCCCAGCAGGCAGGAGG - Intronic
1021502455 7:21345895-21345917 CCCAGTGAGACCAAAGCAGAAGG - Intergenic
1021920835 7:25483385-25483407 CACAGGGACCAGAGAGCAGATGG + Intergenic
1022022995 7:26419107-26419129 CTCTGTGCGCAGAAAGCAGACGG - Intergenic
1022611199 7:31875229-31875251 CCTAGTGTCCAGAAAGGAAAGGG + Intronic
1023001655 7:35814024-35814046 CCCAGTGACCAGCACACAGCAGG - Intronic
1023900076 7:44469227-44469249 CACAGAGAACAAAAAGCAGATGG - Intronic
1024054585 7:45651791-45651813 CTGAGTGACCAGGAAGGAGAGGG + Intronic
1024202480 7:47121204-47121226 AGCAGTGGCCAGAAAGTAGAAGG + Intergenic
1024661537 7:51500068-51500090 ACCAGTGACCACAAGCCAGAGGG - Intergenic
1026741789 7:72983502-72983524 CCCAGGGTCTAGAAAGTAGAAGG - Intergenic
1026801632 7:73403930-73403952 CCCAGGGTCTAGAAAGTAGAAGG - Intergenic
1026870981 7:73851532-73851554 CCCAGAGACTAAAAACCAGAAGG + Intergenic
1027101946 7:75381575-75381597 CCCAGGGTCTAGAAAGTAGAAGG + Intergenic
1027452561 7:78349537-78349559 CATAGTGACCATAAAGCAGGTGG - Intronic
1028344005 7:89758083-89758105 CCCAGCTATCAGGAAGCAGATGG + Intergenic
1028902709 7:96118967-96118989 CCCACTGAGCAGAACCCAGAGGG + Intergenic
1029677579 7:102081011-102081033 CGAAGTGGCCAGAAACCAGAAGG - Intronic
1031014716 7:116560532-116560554 CCCTTTGCCCAGAAAGAAGATGG + Exonic
1032422474 7:131793715-131793737 CCATGTGACCCCAAAGCAGAAGG - Intergenic
1033020146 7:137716450-137716472 ACCAGTGACCAGAAGACAGCCGG + Intronic
1034098904 7:148435384-148435406 CACAGTGACCAGCCAGCACAAGG + Intergenic
1035808637 8:2473080-2473102 CCCAGTGCCACTAAAGCAGAGGG + Intergenic
1037573039 8:20174667-20174689 CCGAGTCACCACACAGCAGATGG + Intronic
1038361730 8:26886215-26886237 CACAGTTACCCAAAAGCAGAGGG + Intergenic
1038738560 8:30195619-30195641 CACAGAGACCAGAAAGCAGTAGG + Intergenic
1039800096 8:40946571-40946593 GCCAGTGGCCAGACAGGAGATGG + Intergenic
1040963527 8:53061098-53061120 CCCAGTGACCTGAAAGACTAGGG + Intergenic
1041043703 8:53871836-53871858 CCTAGAGACCAGGAAACAGAGGG - Intronic
1041481225 8:58321609-58321631 AACATTCACCAGAAAGCAGAAGG + Intergenic
1042102163 8:65285120-65285142 CCCTGTGACCAGAGAGTACAGGG - Intergenic
1042799454 8:72702907-72702929 CGCAGTGCACAGAAAGCAGATGG - Intronic
1042843259 8:73146119-73146141 CCCAGACACCAAAAGGCAGATGG + Intergenic
1044343969 8:91081489-91081511 CCCTGTGGCCACAAAACAGAGGG - Intronic
1046031040 8:108784535-108784557 CCCAGTGACCAAGAACAAGATGG + Exonic
1046212120 8:111089730-111089752 CCCAGGAACCTGAAAGGAGAAGG + Intergenic
1046942824 8:119947529-119947551 CCCACTGGCTAGAAACCAGAAGG - Intronic
1049261229 8:141640334-141640356 GCCAGGGGCCAGAAAGCAGGTGG + Intergenic
1049363546 8:142225555-142225577 CCCTGTGGTCAGAAGGCAGAGGG - Intronic
1049541977 8:143212833-143212855 GCCAGTGACCAGCAAATAGAGGG + Intergenic
1050619211 9:7435004-7435026 CCCAGAGACAAGGAAGCAGATGG - Intergenic
1051141507 9:13984394-13984416 CCCTGTGAGCACAAAGCAGCTGG + Intergenic
1051583206 9:18699438-18699460 CCCAGTGACCAGGAAGGCTAAGG - Intronic
1053414661 9:37939521-37939543 CCCAGAGACCTGAAACCAGAGGG - Intronic
1053557581 9:39154105-39154127 ACCAGTGACTCAAAAGCAGAAGG + Intronic
1053821694 9:41974393-41974415 ACCAGTGACTCAAAAGCAGAAGG + Intronic
1054139533 9:61464846-61464868 ACCAGTGACTCAAAAGCAGAAGG - Intergenic
1057228498 9:93304871-93304893 CCCAGTGACCAGTGTGCAGACGG - Intronic
1057548254 9:96034025-96034047 CCCAGTGACCGGAGAGCAGCGGG - Intergenic
1059503549 9:114777610-114777632 CCTAGTGAGGAGAAAGGAGAGGG - Intergenic
1059649236 9:116299741-116299763 CTCTGTGACCTGGAAGCAGATGG + Intronic
1060094529 9:120775935-120775957 AACAGTGACCAGCAAGTAGAAGG - Intronic
1060472454 9:123959540-123959562 CACAGTGATCAGAAACAAGATGG + Intergenic
1060738770 9:126083890-126083912 CCAAGTGGCCAGAAAGAAGAAGG - Intergenic
1061295889 9:129676545-129676567 CACAGTGTCCTGAAAGCACATGG - Intronic
1061382748 9:130268239-130268261 CTCAGTGCCCAGAGAGGAGAGGG - Intergenic
1062188429 9:135231067-135231089 CCCAGAGAGCAGGCAGCAGACGG + Intergenic
1062610270 9:137370362-137370384 CCCAGGGAGCAGACAGCAGAAGG + Intronic
1185433215 X:21386-21408 ACCAGTGACCAGAAACCGGGTGG - Intergenic
1185442417 X:233454-233476 ACCAGTGACCAGAAACCGGGTGG - Intergenic
1188634962 X:32418134-32418156 CTCAGAGGCCAGAAAGCAAAGGG + Intronic
1189268647 X:39735439-39735461 ACCACTGGCCAGAAAGAAGAAGG + Intergenic
1190278551 X:48914493-48914515 CCCAGTGACCAGACAGTGGCCGG + Exonic
1190978642 X:55433449-55433471 CCCAGTGGAGATAAAGCAGATGG - Intergenic
1191875465 X:65790532-65790554 CCCAGGGAACAGAAAACCGAGGG - Intergenic
1192556731 X:72096019-72096041 CCCTGTGACCTGAAAGCTCAGGG - Intergenic
1193539200 X:82750906-82750928 CTCAGTGACCTGAAAGCCAAAGG + Intergenic
1193645606 X:84065863-84065885 CCCAGTGAGACCAAAGCAGAAGG + Intronic
1194021160 X:88694243-88694265 CCCAGTGAGATCAAAGCAGAAGG + Intergenic
1195742143 X:108075652-108075674 CCCAGTGACCAGAGTGCATGAGG + Intronic
1195871163 X:109487771-109487793 CCCAGTGATTAGAAACCAGATGG - Intergenic
1196367910 X:114943565-114943587 CCCAGTGACATCAACGCAGAGGG - Intergenic
1197378910 X:125714149-125714171 ACCAGTGACCAGAAAATAGGTGG - Intergenic
1199164623 X:144656841-144656863 CCAAGTGACAACAAAGGAGACGG + Intergenic
1200248935 X:154541988-154542010 CCCAGTGGCCAGGAACCAGCTGG - Intronic
1200797253 Y:7352323-7352345 CCCAGAGACCAGAAGAAAGATGG - Intergenic
1201329727 Y:12804667-12804689 CTCAGAGGCCAGAAAGCAGTGGG - Intronic
1201537736 Y:15069137-15069159 CCCAGTGAGATGAATGCAGAAGG + Intergenic
1202138927 Y:21700572-21700594 TCCAGTCCCCAGAAAGCACAGGG + Intergenic