ID: 1142188277

View in Genome Browser
Species Human (GRCh38)
Location 16:88705216-88705238
Sequence CTCCTGGTACAGAGGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 1, 2: 3, 3: 25, 4: 269}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142188277 Original CRISPR CTCCTGGTACAGAGGGAGCT GGG (reversed) Intronic
900385486 1:2408704-2408726 CTCCTGCTCCAGGGGGAGCAGGG + Exonic
900658676 1:3772489-3772511 CGCCTGGTCCAGAAGGGGCTGGG - Intergenic
901131672 1:6965490-6965512 CCCCTGGCTCAGAGGGGGCTGGG + Intronic
901666774 1:10830631-10830653 CTCCTGGGGCAGGGGGCGCTGGG + Intergenic
901685963 1:10943469-10943491 CTCCTGGATCAGAGGTTGCTGGG + Intergenic
901827047 1:11868993-11869015 ATCCTGACACAGAGAGAGCTGGG - Intergenic
902369527 1:15997179-15997201 CTCCTGGGACAGGGGAACCTTGG - Intergenic
902448741 1:16483924-16483946 GTCCTGGTAGAGAGGGAGACAGG - Intergenic
902468121 1:16630594-16630616 GTCCTGGTAGAGAGGGAGACAGG - Intergenic
902506038 1:16939435-16939457 GTCCTGGTAGAGAGGGAGACAGG + Intronic
903155020 1:21437094-21437116 GTCCTGGTAGAGAGGGAGACAGG + Intergenic
903181542 1:21607609-21607631 CTGCTGGTACAAAGGCTGCTAGG - Intronic
903353824 1:22734202-22734224 CTCCTGCTAAAGAGGCAGCCAGG - Intronic
903464944 1:23545445-23545467 CTGCTGGGACAGAGGGAGTTGGG + Intergenic
904360070 1:29965466-29965488 CCCCTGGAAAAGAGGGAGGTTGG - Intergenic
904488426 1:30843202-30843224 CTCCTGGTATATAGGGAGCTTGG + Intergenic
904495194 1:30882541-30882563 CTCCTGGGAGGGAGGGGGCTGGG - Intronic
905797030 1:40821524-40821546 CTCCTGCTGCAGAGGAAGCTCGG + Intronic
906678109 1:47708030-47708052 CACCTGGGACAGCGGGATCTGGG - Intergenic
908246098 1:62228691-62228713 CTCCTGTTTCAGTGAGAGCTGGG - Intergenic
908268325 1:62399659-62399681 CCCCTTGTACAGTGGGAGCCAGG - Intergenic
908294305 1:62698016-62698038 CTCTTGAAACAGAGGGAGCAGGG + Intergenic
911458857 1:98162977-98162999 CTCCAGGTGCAGAGGGAGTAAGG + Intergenic
911632494 1:100199089-100199111 CAGCTGGTAGAGGGGGAGCTTGG + Intronic
914905856 1:151743094-151743116 CTCTTGGTGGAGAGGGAGCCTGG - Intergenic
916070228 1:161165794-161165816 CACCTGTTAGAGAGGGAACTTGG - Intergenic
917711175 1:177687126-177687148 ATCCAGGAACAGAGGGAGCCAGG + Intergenic
917968836 1:180194706-180194728 CTGCTAGGGCAGAGGGAGCTGGG + Intronic
918087483 1:181257967-181257989 TTCCTGGTACCTAGGTAGCTTGG - Intergenic
918425050 1:184400537-184400559 CCCATGGTACAGAGTGATCTCGG - Intronic
920506160 1:206516972-206516994 CTTCTGGTACAGAGGTTGCTTGG + Intronic
921218406 1:212955913-212955935 CTCCTGCAACAGAGGCAGCCAGG - Intronic
923719069 1:236451903-236451925 TTCCTGGGAGAGAAGGAGCTGGG - Intronic
924064444 1:240208070-240208092 CTCCGGGTAGAGGGGGAGGTGGG - Exonic
924064537 1:240208301-240208323 CTCCGGGTAGAGGGGGAGGTGGG - Exonic
924775987 1:247114710-247114732 CTCAGGGTAGAGAAGGAGCTGGG + Intergenic
1066451428 10:35533537-35533559 CACCTGGGACAGAGGGAGCTGGG - Intronic
1067820503 10:49524659-49524681 CTCCTGTTTCTGAGGGATCTGGG + Exonic
1068137648 10:52965970-52965992 CTCTGGGTCCAGAGGGAGCCAGG - Intergenic
1068892792 10:62165137-62165159 ATCCTGGTGGAGATGGAGCTTGG - Intergenic
1068955444 10:62816053-62816075 CTCCAGGTAGCGAGGGAGTTGGG - Exonic
1070537973 10:77393562-77393584 CCCCTGAGACAGATGGAGCTGGG + Intronic
1071519441 10:86319905-86319927 CTGCTGTCACCGAGGGAGCTAGG - Intronic
1071743170 10:88385668-88385690 ATCCTGGTGCAGAGGTTGCTGGG + Intronic
1071849994 10:89558877-89558899 CTCCCCGTACAGAGGGAGGAGGG + Intergenic
1076195169 10:128512628-128512650 CCCCTGCTCCAGAGGAAGCTGGG + Intergenic
1076684957 10:132194406-132194428 TTCCTAGAACAGTGGGAGCTGGG - Intronic
1077183841 11:1227822-1227844 CTCCAGGTCCAGGGGGAGCTGGG + Intronic
1078520842 11:12061696-12061718 CTCAGGGTTCAGAGGGAGCATGG + Intergenic
1081001497 11:37678529-37678551 GTCCTGGAATAGAGGCAGCTTGG + Intergenic
1081232150 11:40598790-40598812 CTTGTGGAACAGAGGGTGCTGGG + Intronic
1081748453 11:45489398-45489420 CTCCCGATGCAGGGGGAGCTGGG + Intergenic
1085449463 11:76623235-76623257 AGCCTGGGGCAGAGGGAGCTGGG - Intergenic
1085552892 11:77391465-77391487 CTTCTGGTTTAGATGGAGCTGGG - Intronic
1085695954 11:78704960-78704982 CTGCAGGGACAGAGGGAGCTGGG - Intronic
1087114805 11:94513529-94513551 CTCCCGGTGCAGAGGAACCTTGG - Intergenic
1088557723 11:111079761-111079783 GTCATGGTGCAGAGGGTGCTGGG - Intergenic
1089977913 11:122748436-122748458 CTCCGAGTGCACAGGGAGCTGGG - Intronic
1090903054 11:131049328-131049350 CTCCAGGTACAAAGGAAGCTAGG - Intergenic
1091369360 11:135045795-135045817 CTCCTGGTTCAGAAGGAGGGAGG + Intergenic
1091994496 12:4982580-4982602 CCCCTGCTTCAGAGGGAGCCAGG - Intergenic
1094480288 12:30876053-30876075 CTCCTGGCAGAGAGGGAGTGAGG - Intergenic
1095942961 12:47738322-47738344 TCCTTGGTTCAGAGGGAGCTTGG - Intronic
1096981049 12:55728499-55728521 CTGCGGGTAAAGAGGGGGCTGGG - Intronic
1097905883 12:64919330-64919352 CTGCTGGTACAGTGGGTGCTTGG + Intergenic
1098300304 12:69047523-69047545 AGCCTGGTACAGAAGGAGCCAGG + Intergenic
1098430560 12:70415071-70415093 TTTCTGGTACAGAGGCAGCATGG - Intronic
1101407061 12:104438037-104438059 CCTCTGGTAGAGAGGGAGGTAGG + Intergenic
1101861589 12:108486600-108486622 GTCCTGGTACAGTGGGAGGAAGG + Intergenic
1102455346 12:113067313-113067335 CCCCTAGAACAGAGGAAGCTGGG - Intronic
1103595820 12:122023688-122023710 CCCCTGGTACACAGGGTGCCCGG + Intronic
1103855329 12:123964909-123964931 CTGCTGGTACAAAGGGAATTAGG - Intronic
1104415827 12:128596072-128596094 GTCCTGGTACAGAGGCAGCAGGG + Intronic
1104415841 12:128596145-128596167 GTCCTGGTACAGAGGTGGCACGG + Intronic
1104415856 12:128596218-128596240 GTCCTGGTACAGAGGCGGCAGGG + Intronic
1104415871 12:128596291-128596313 GTCCTGGTACAGAGGCGGCAGGG + Intronic
1104415885 12:128596364-128596386 GTCCTGGTACAGAGTGGGCAGGG + Intronic
1104415914 12:128596510-128596532 GTCCTGGTACAGAGGCGGCAGGG + Intronic
1104415928 12:128596582-128596604 GTCCTGGTACAGAGGCACCAGGG + Intronic
1104415944 12:128596655-128596677 GTCCTGGTACAGAGGCAGCAGGG + Intronic
1104415959 12:128596727-128596749 GTCCTGGTACAGAGGTGGCAGGG + Intronic
1104664066 12:130635041-130635063 CCCCTGGGGCAGGGGGAGCTGGG - Intronic
1104982010 12:132577365-132577387 CTCCTGGGAAAGCGGGGGCTGGG - Intronic
1104983215 12:132583050-132583072 CTCCGGGCCCAGAGCGAGCTGGG + Exonic
1107878060 13:44807915-44807937 ATCTGGGGACAGAGGGAGCTGGG - Intergenic
1109391972 13:61705505-61705527 CTGATGGTGCAGATGGAGCTGGG - Intergenic
1113828692 13:113277169-113277191 AACCTGGTACAGAGAGAGCTTGG + Intergenic
1113948747 13:114059587-114059609 CTGCGGGCACAGAGGGCGCTCGG + Intronic
1117294611 14:54367468-54367490 CACCTGGATCAGAGGGCGCTGGG - Intergenic
1118552119 14:66964665-66964687 GATCTGGTAGAGAGGGAGCTAGG + Intronic
1119330414 14:73789329-73789351 AGCCTGGTAGAAAGGGAGCTAGG + Intronic
1120900665 14:89572941-89572963 CTCCTGGCAGAGAGGGAGGCAGG + Intronic
1121635819 14:95453261-95453283 CTCCTGGGATTGAGGGAGCTGGG - Intronic
1122259204 14:100502476-100502498 CTCCTGGAGCTGGGGGAGCTGGG + Intronic
1122804470 14:104249671-104249693 CTGGTGGGACAGAAGGAGCTAGG + Intergenic
1122859656 14:104576855-104576877 CTCCTGCTACAGAGGGAGCTGGG + Intronic
1124176925 15:27435005-27435027 GGCCTGGCACAGAGAGAGCTTGG - Intronic
1126363643 15:47871528-47871550 CTCCTGGTAAACAGGGGGCCAGG - Intergenic
1128150725 15:65362099-65362121 GAAGTGGTACAGAGGGAGCTGGG + Intronic
1128677891 15:69625099-69625121 CTCCTGGTCCAAGGGGATCTGGG - Intergenic
1129172349 15:73816046-73816068 CTCATGGGACAGAGGTAGGTTGG - Intergenic
1129519741 15:76178142-76178164 CTGCTGGGACAGAGGAAGCCTGG + Intronic
1131003260 15:88955158-88955180 CTCCTGGTGCCAAGGGAACTGGG - Intergenic
1132662528 16:1068030-1068052 GTCCAGAGACAGAGGGAGCTGGG - Intergenic
1132762978 16:1519943-1519965 CTCCTGGTCCAGGGGGCTCTTGG + Exonic
1132990691 16:2791325-2791347 CTCCCTGTTCAGTGGGAGCTGGG + Intergenic
1133025691 16:2988125-2988147 CTCCTGCCACAGGGGGAGGTGGG + Intergenic
1133049885 16:3111669-3111691 GAGCTGGTACAGAGGCAGCTGGG + Intergenic
1140893664 16:79306479-79306501 CTCCTGGTAGAGAGGAAGAGAGG + Intergenic
1141461136 16:84179458-84179480 CTCCTGCTGCAGAGAGACCTGGG - Exonic
1141625331 16:85258552-85258574 CTCCAGGTGGAGGGGGAGCTGGG + Intergenic
1142188277 16:88705216-88705238 CTCCTGGTACAGAGGGAGCTGGG - Intronic
1142963003 17:3563065-3563087 ATCCTGGGCCAGAGGGAGGTGGG - Intergenic
1143163629 17:4886733-4886755 CTCCTTGGACAGGGAGAGCTGGG - Intronic
1144367096 17:14555107-14555129 GTCCTGCTACTGAGGGTGCTGGG + Intergenic
1144838836 17:18173157-18173179 CTCCTGGGGGTGAGGGAGCTGGG + Intronic
1146954712 17:36930803-36930825 CTGGTGGTCCAGAGAGAGCTGGG - Intergenic
1147004219 17:37388844-37388866 CTTCTGTTCCAGAGGCAGCTTGG + Intronic
1149130118 17:53289887-53289909 CTCTTGGTCCAGAGAGAGTTGGG - Intergenic
1150939476 17:69674824-69674846 CACCTGGGACAGAGGGTGCCAGG + Intergenic
1151734884 17:75933170-75933192 CTCCTAATACAGAGACAGCTTGG - Intronic
1152226135 17:79093748-79093770 CTCTGGGTGCAGAGTGAGCTGGG + Intronic
1153929974 18:9869773-9869795 CTCCTTTTACAGAAGGAGCATGG + Intergenic
1153953530 18:10076718-10076740 CTGTTGGCACAGAGGGAGCTTGG - Intergenic
1160124301 18:76156158-76156180 ATCCTGGTGTGGAGGGAGCTCGG - Intergenic
1160390685 18:78529176-78529198 CTCCCAGAACAGAGGGATCTGGG + Intergenic
1160514728 18:79472064-79472086 GTGTTGGTACAGAGGGAGCCGGG + Intronic
1160629099 18:80232965-80232987 CTCCTTGCACACAGGGACCTGGG + Intronic
1160800026 19:963487-963509 CTCCTGGTGCAGGGGCAGCCTGG + Intronic
1161026956 19:2041321-2041343 CGCCTGGGGCAGAGGGGGCTGGG + Intronic
1161109894 19:2463175-2463197 AGCCTGGTTCTGAGGGAGCTCGG + Intergenic
1161157342 19:2739518-2739540 TTTGTGCTACAGAGGGAGCTAGG + Intronic
1162015634 19:7845160-7845182 CTCCTGCTACAGAGCGTGCCGGG + Intronic
1163430996 19:17267565-17267587 CTCTTGGGGCAAAGGGAGCTGGG - Intronic
1163817064 19:19473178-19473200 CTCATGGTACAAGGGGAGGTGGG - Intronic
1164050629 19:21583455-21583477 CTCCTGCTACAGAGCTTGCTGGG + Intergenic
1164064801 19:21706598-21706620 CTACTGGTGCAGAGGGAGGCTGG - Intergenic
1164109299 19:22140184-22140206 CTCCTGATGCAGAGGGAGGCTGG + Intergenic
1164151514 19:22556966-22556988 CAGCTGGAGCAGAGGGAGCTAGG - Intergenic
1164169212 19:22709485-22709507 CTCCCGGTGCAGAGGGAGGCTGG - Intergenic
1166181430 19:41111970-41111992 CTCCTGCTACAGAGGGAACTTGG - Intergenic
1166388645 19:42396693-42396715 CTCCTGGGTCAGAGGGAGGAGGG - Intergenic
1166504219 19:43361440-43361462 CTCCTGGGACAGGGGCAGCTGGG - Exonic
1166506190 19:43373129-43373151 CTCCTGGGACTGAGGGAGAAGGG - Intergenic
1166506240 19:43373318-43373340 CTCCTGGGACAGGGGCAGCTGGG + Intergenic
1166523176 19:43495026-43495048 CTCCTGGGTCTGAGGGAGGTGGG + Intronic
1166523938 19:43499327-43499349 CTCCTGGGTCAGAGGGAGGAGGG + Intronic
1166523972 19:43499437-43499459 CTCCTGGGACAGAGGGAGAAGGG + Intronic
1166531532 19:43546246-43546268 CTCCTGGATCAGAGGGAGGAGGG - Intronic
1166569491 19:43784766-43784788 CTCCTGGTTCTGAGGGAGGAGGG + Intergenic
1166569532 19:43784891-43784913 CTCCTGGTTCTGAGGGAGGAGGG + Intergenic
1166662120 19:44654096-44654118 CTCCTGGGACTGAGGGAGAAGGG + Intronic
1166695901 19:44851316-44851338 CTCCTGGGTCTGAGGGAGCAGGG - Intronic
1166933937 19:46319882-46319904 TTCCTTTTACAGAAGGAGCTTGG + Intronic
1167264804 19:48478203-48478225 CTCCTGGGGCTGAGGGAGGTGGG + Intronic
1167413827 19:49360342-49360364 CTCCTGGGTCTGAGGGAGCGGGG + Intronic
1167632181 19:50632110-50632132 CTCCTGGATCTGAGGGAGGTTGG - Intronic
1167668924 19:50838776-50838798 CTCCTGGGTCTGAGGGAGGTGGG + Intergenic
1167669009 19:50839032-50839054 CTCCTGGGTCTGAGGGAGCTGGG + Intergenic
1167690087 19:50979997-50980019 CTCCTGGTTCCGAGGGAGGAGGG + Intronic
1167795398 19:51704964-51704986 CTCCTGGTTCTGAGGGAGGAGGG - Intergenic
1168095894 19:54114749-54114771 CTCCTGGTTCAGTGGGAGAAGGG - Intronic
1168238696 19:55078747-55078769 CTCCTGGGTCAGAGGGAGGAGGG + Intronic
927187227 2:20490601-20490623 CTCCTGGTACAGAGACCCCTGGG + Intergenic
930018676 2:46987594-46987616 CTCTGGGTCCAGAGTGAGCTTGG + Intronic
931434688 2:62236255-62236277 CTCCTGGGCCAGAGCAAGCTGGG + Intergenic
931478434 2:62614777-62614799 CTTCTGGTACAGAGTGAATTGGG - Intergenic
932211039 2:69930775-69930797 CTCCTTCTACAGAGGAAGCTAGG + Intronic
932688738 2:73894740-73894762 TTCCTGGTAAAGAGGAAGCATGG + Intronic
933805912 2:85997926-85997948 CTCCTTCTACAGAGGGTGATAGG - Intergenic
934852212 2:97708458-97708480 CTCCTGGCTCAAAGGGAGCTTGG - Intergenic
937984995 2:127634413-127634435 CTGCTGGGACAGAGGTAGGTGGG + Intronic
938016088 2:127868345-127868367 CTCCTTGTACAGAGTGTGTTAGG + Intronic
939958472 2:148546179-148546201 CTTCTGGATCCGAGGGAGCTTGG + Intergenic
942458112 2:176151677-176151699 CTCCTCGCACGGAGGGAACTTGG - Exonic
944012086 2:194984399-194984421 CTTCTGGTAGAGAGGGGGATGGG - Intergenic
945589663 2:211714689-211714711 GTCCTGGTAGAGATGGATCTTGG + Intronic
946158420 2:217821761-217821783 CTGCTGGTGGAGAGGGGGCTGGG + Exonic
947701759 2:232240242-232240264 CTCCTGGAGCAGGTGGAGCTAGG - Intronic
948667632 2:239546269-239546291 ATCCTGGGAGAGAGGGAGATGGG - Intergenic
948729963 2:239956595-239956617 CTCCTGGGACAAGGTGAGCTTGG - Intronic
1170407089 20:16049900-16049922 CTCCTGGCTCTGGGGGAGCTCGG + Exonic
1170790548 20:19505674-19505696 ATCCAGGTAATGAGGGAGCTGGG + Intronic
1172870723 20:38134024-38134046 CTACTGCTAAAGAGGGAGATTGG + Intronic
1173920982 20:46744406-46744428 GCCCTGGGACAGCGGGAGCTAGG - Intergenic
1175328164 20:58143965-58143987 CTCCTGGATCAGAGGAAGTTTGG - Intergenic
1175674067 20:60931811-60931833 CTCCTGCTACAGAGGAAGTAGGG - Intergenic
1176027684 20:62994127-62994149 CTCCTGGTCCAGAGGCATCCAGG + Intergenic
1179232770 21:39519864-39519886 CGCCAGTTACAGAGGGAACTGGG + Intergenic
1180163612 21:46009073-46009095 GTCCTGGTGCAGGAGGAGCTGGG + Intergenic
1183397652 22:37581681-37581703 CTCCTGGCACCGAGGGCCCTCGG - Intronic
1183473326 22:38021284-38021306 TTGCTGGTAGAGAGGGAACTTGG + Intronic
1183989629 22:41589427-41589449 CTCCGGGGAGGGAGGGAGCTAGG + Intronic
1184457324 22:44618569-44618591 CTCCAGGTGCAGAGGGAGAAGGG + Intergenic
1185171020 22:49294747-49294769 GTCCTGCCACAAAGGGAGCTGGG - Intergenic
1185193576 22:49453982-49454004 CTGCTGGTAAAGAAGGAGCAGGG + Intronic
949289464 3:2447212-2447234 CTCCTTGTATGGAGGGAGGTGGG - Intronic
949996723 3:9623117-9623139 CTACAGTTACAGAGGGAGCATGG + Intergenic
950615839 3:14157571-14157593 CTCCTGGGAAAGAGGGGTCTCGG - Intronic
950859439 3:16134716-16134738 ATCCTGGCACAGAATGAGCTTGG + Intergenic
951848524 3:27112020-27112042 CTTCTGGGAAAAAGGGAGCTAGG - Intronic
954135115 3:48578882-48578904 ATGCTGGGACAGAGGGGGCTCGG - Intronic
954150119 3:48653113-48653135 CACCTGGTCCAGAAGGAGATGGG + Exonic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
956656795 3:71560095-71560117 CTTCAGGTACAGATGGAGCCAGG - Intronic
959925201 3:111913299-111913321 CTCCTGGAACACAGGGAGGAGGG - Exonic
963004952 3:140718327-140718349 ATCCTGGTACATAGGATGCTTGG - Intergenic
963889821 3:150621447-150621469 CACTTGGTACAGAGGAAGCAGGG - Intronic
964376127 3:156050869-156050891 CTCCTGATACTGTGAGAGCTTGG + Intronic
966501506 3:180646753-180646775 CTGCTAGTACACAGAGAGCTAGG - Intronic
967173565 3:186842994-186843016 ATCCTGCTACAGAGCGAACTGGG - Intronic
967859835 3:194142060-194142082 CCCCGGCTACACAGGGAGCTCGG - Intergenic
968455372 4:695763-695785 CTCCAGGGACAGAGGTAGGTGGG + Intergenic
968628180 4:1637417-1637439 CTCGAGGGACAGAGGGAGCCTGG + Intronic
968730681 4:2267931-2267953 CCCCTTGGACACAGGGAGCTTGG + Intergenic
968919767 4:3516496-3516518 CTCCTGCTTCAGAGGCAGCCAGG - Intronic
969957613 4:10907893-10907915 CTCCTAGTTCAGAGGGGGCTAGG + Intergenic
975031758 4:69629202-69629224 CTCCAGGTAGAAAGGGAGCCAGG + Intronic
976074719 4:81284741-81284763 CGGCTGGAGCAGAGGGAGCTGGG - Intergenic
977146278 4:93444332-93444354 GGCCTGCTAAAGAGGGAGCTAGG + Intronic
977223963 4:94372729-94372751 CACCTGCTACAGATGGAACTTGG + Intergenic
977936651 4:102813666-102813688 CTCCTGGAACAGAAGGTCCTAGG + Intronic
979151198 4:117316840-117316862 CTGGTGGTCCAAAGGGAGCTTGG - Intergenic
980423896 4:132600035-132600057 CTGCTGGGACAGATGGAGGTTGG - Intergenic
981790915 4:148535753-148535775 CTCCTGGCACAGAGGGGAGTGGG - Intergenic
983800641 4:171925145-171925167 CTCCTGGTAAAGGGTGAGCAGGG + Intronic
988323967 5:29737970-29737992 GTGTTGGTACAGAGGGGGCTGGG - Intergenic
989163158 5:38410672-38410694 CTCCTGGGCCATAGGGAGGTTGG + Intronic
990821845 5:59850085-59850107 CTCCTGGGACAAAGGAAGTTTGG - Intronic
993925812 5:93864900-93864922 CTCCTGGTAAAGAGGGATTCTGG + Intronic
994458219 5:100041761-100041783 CACCTGTTACAGAGAGAGCAGGG + Intergenic
1001330820 5:170761170-170761192 TGCCTGGTACAGATGGAGCCTGG + Intergenic
1001391524 5:171383295-171383317 TTCCTGGTTCAGACGGAGCTTGG - Intergenic
1005859865 6:29892078-29892100 CTCCTGATCCTGAGGGAGGTGGG - Intergenic
1006425769 6:33962016-33962038 CTCCTGTTGCAGTGGGAGCAGGG + Intergenic
1007418367 6:41705281-41705303 CTCATTGTTCAGATGGAGCTGGG - Intronic
1007479747 6:42142270-42142292 CTCCGGGGACGGAGGGCGCTGGG - Intronic
1012834842 6:104252043-104252065 CTACTGTAACAGAGGGAGCAAGG + Intergenic
1014641559 6:123916880-123916902 CTCTTGATACAGAGAGAGGTAGG - Intronic
1016825743 6:148386977-148386999 TTCCCAGGACAGAGGGAGCTGGG - Intronic
1016838096 6:148499488-148499510 GTCCTTGTACACAGGGAGCTTGG + Intronic
1016887342 6:148970524-148970546 CTCCTGATACAGAGGTAACCTGG - Intronic
1018366263 6:163123060-163123082 TCCCCGGTACAGAAGGAGCTGGG + Intronic
1018739735 6:166718224-166718246 CTCCAGGCACAAAGGGAACTAGG + Intronic
1019309127 7:351770-351792 CTCCGGGGACGGAGTGAGCTGGG - Intergenic
1019509572 7:1411057-1411079 CTCCTAGAGCAGATGGAGCTCGG + Intergenic
1019895313 7:3977749-3977771 CTCCTGGAACAGAAGCACCTTGG + Intronic
1021103244 7:16607820-16607842 CTTCTGTTACTGAGGAAGCTGGG - Intronic
1022455934 7:30558542-30558564 CTCCTGGTACAGGGGAAGGAAGG + Intergenic
1022891244 7:34702130-34702152 CTCATGGTACAGATGGCGGTTGG + Intronic
1023873658 7:44275818-44275840 ATCCAGGTACAGAAGGAGTTAGG - Intronic
1024135839 7:46407066-46407088 CTCCTAAAACAGAGGGAGCCTGG + Intergenic
1024512677 7:50215829-50215851 CTCATGTTCCAGGGGGAGCTTGG + Intergenic
1024657838 7:51466957-51466979 AGCCTGGTGCACAGGGAGCTGGG - Intergenic
1025769892 7:64494949-64494971 CTCCTGGCACAGAGGAAGGCTGG + Intergenic
1026006051 7:66601198-66601220 ATCCTGGTAGAGCAGGAGCTGGG - Intergenic
1026685459 7:72505587-72505609 CTCTTGGTACACAGTTAGCTTGG - Intergenic
1027346191 7:77262109-77262131 TACCTGGAACAGAGGGATCTTGG + Exonic
1029128497 7:98312223-98312245 CTCCTGCCACCGAGGCAGCTTGG + Exonic
1029504108 7:100951689-100951711 CTCCTGCATCAGAGGCAGCTTGG - Intronic
1029595773 7:101536982-101537004 CTCCTGGTTGCAAGGGAGCTGGG + Intronic
1031392935 7:121238213-121238235 CTTCTGGTACTTAAGGAGCTAGG + Intronic
1032194295 7:129780540-129780562 CTCCGGGCTCAGAGGGCGCTGGG - Intergenic
1032624034 7:133570005-133570027 ATCTTGGTACAGAAGGGGCTAGG - Intronic
1033656789 7:143380720-143380742 CTCCGGGCACAGAGTCAGCTGGG + Intergenic
1035061635 7:156073715-156073737 CTCCAGGTAAAAACGGAGCTAGG - Intergenic
1040722727 8:50345557-50345579 TTCCTGGTTCATAGGGAGGTGGG + Intronic
1042835948 8:73079303-73079325 CTCCTGGGGGAGAGGGAGATTGG - Intronic
1044716285 8:95102678-95102700 CTGCTGGTACTGAAGGAGCCAGG + Intronic
1045112502 8:98948240-98948262 CTCCTGGGCCAGAGGGCCCTGGG - Exonic
1046101578 8:109620524-109620546 TTCCTGGAACAGAGTGAACTTGG + Intronic
1047290503 8:123525452-123525474 CTCATTCTACAGAGAGAGCTAGG + Intronic
1047915754 8:129582252-129582274 CTCAAGGTGCAGAGGGAGATTGG + Intergenic
1048719508 8:137307885-137307907 CTCCTGGGACAGTGAGAGTTGGG + Intergenic
1049340448 8:142109542-142109564 CTCCTGGTCCCCAGGCAGCTGGG + Intergenic
1049610405 8:143552579-143552601 CTCCTGGGGCAGAGGGCGATGGG - Intergenic
1049847103 8:144808142-144808164 CTTCTGGTGCAGAGTGAGGTTGG - Exonic
1053019120 9:34682711-34682733 GTCCTAGTGCAGAGGGGGCTGGG - Intergenic
1053271002 9:36749488-36749510 CTCCTGTTAGAGAGGGTGCAAGG + Intergenic
1055574141 9:77646143-77646165 CCCCTAGGAGAGAGGGAGCTTGG - Intronic
1056454435 9:86746325-86746347 CTCCAGGAACAGAGTGAGCGAGG + Intergenic
1057009266 9:91587100-91587122 TCCCTGTTACACAGGGAGCTGGG - Intronic
1057141963 9:92731870-92731892 CTCCTGATGCACAGGCAGCTGGG + Intronic
1057302435 9:93894629-93894651 CTCCATGTGCAGAGGGACCTGGG + Intergenic
1059342014 9:113602589-113602611 CGCCGCGTACAGAGGCAGCTTGG - Intergenic
1060867046 9:127008657-127008679 ATTATGGTACAGACGGAGCTGGG + Intronic
1061845454 9:133385645-133385667 CTCCTGGTACACAGAGATGTGGG - Exonic
1062558376 9:137127588-137127610 GTCCTGCTACAGAGGTAGCATGG - Intergenic
1062606075 9:137349446-137349468 CTCCTGGTGCAGCAGGTGCTGGG - Exonic
1187792354 X:22964698-22964720 CTCCTGTCACAGAGAGTGCTGGG + Intergenic
1191202128 X:57794820-57794842 CTCCTGGTAAGGAGGGAGTTTGG + Intergenic
1194244980 X:91500051-91500073 CTCCTGGTTCAGGGTCAGCTGGG - Intergenic
1199594490 X:149495860-149495882 CCCTTGGTGCAGAGGGAACTGGG - Intronic
1199814376 X:151384937-151384959 CAGCTGGCACAGAGGCAGCTAGG - Intergenic
1199852672 X:151736716-151736738 TTCCTGGTACAGAAGGAGCAGGG + Intergenic
1200135154 X:153871209-153871231 CTCCTGGTCCAGATGGTGCTAGG + Intronic
1200563955 Y:4741361-4741383 CTCCTGGTTCAGGGTCAGCTGGG - Intergenic
1202178118 Y:22116306-22116328 CTCCTGGGAGAGAGAAAGCTTGG + Intergenic
1202213243 Y:22470089-22470111 CTCCTGGGAGAGAGAAAGCTTGG - Intergenic