ID: 1142188597

View in Genome Browser
Species Human (GRCh38)
Location 16:88706579-88706601
Sequence TACCTGGGCCGCGGCGCCGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142188597_1142188605 -8 Left 1142188597 16:88706579-88706601 CCCCCGGCGCCGCGGCCCAGGTA 0: 1
1: 0
2: 0
3: 16
4: 151
Right 1142188605 16:88706594-88706616 CCCAGGTAAGAGCTGGCGGCCGG 0: 1
1: 0
2: 4
3: 21
4: 225
1142188597_1142188607 2 Left 1142188597 16:88706579-88706601 CCCCCGGCGCCGCGGCCCAGGTA 0: 1
1: 0
2: 0
3: 16
4: 151
Right 1142188607 16:88706604-88706626 AGCTGGCGGCCGGACCCGCCAGG 0: 1
1: 0
2: 1
3: 10
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142188597 Original CRISPR TACCTGGGCCGCGGCGCCGG GGG (reversed) Exonic
902350110 1:15847965-15847987 TGCCGGGGCGGCGGCGGCGGCGG - Exonic
903255586 1:22096658-22096680 TGCCTGTGCCGCGGTGCAGGTGG + Intergenic
903514745 1:23902872-23902894 GACCGCGGCCGCGGCGCTGGCGG + Intronic
903514805 1:23903074-23903096 TTCATGGGCGGCGGCGGCGGCGG + Intronic
903879658 1:26500387-26500409 CACCTGGGAGGCGGCGCCCGCGG + Intergenic
904641987 1:31938057-31938079 CACCTCGGCGGCGGCGGCGGCGG + Exonic
905449166 1:38046232-38046254 TACCCGGGGGGCGGCGGCGGCGG - Exonic
905461344 1:38124859-38124881 TACCTGGGCCCTGGCTCCAGAGG - Intergenic
906204390 1:43979327-43979349 TCCATGGCCCGCGGCGGCGGCGG + Intronic
906640676 1:47438867-47438889 TGGCGGGGCCGCGGCGGCGGGGG + Exonic
907962519 1:59296760-59296782 TACAGGGGCCGCGCCGGCGGGGG + Intronic
909475205 1:76074602-76074624 GTCCTGGGCGCCGGCGCCGGCGG - Intergenic
911527541 1:99004752-99004774 CACCGGGGGCGCGGCGGCGGAGG + Exonic
921229185 1:213051330-213051352 AACCTGGACCGCGGCGGCGCCGG + Exonic
922792105 1:228316377-228316399 TTCCTGGGCCTCGGCCCCGGGGG - Intronic
923171469 1:231421559-231421581 TCCCTTGGCCGCGTCCCCGGAGG + Exonic
923181917 1:231528287-231528309 TCCCTGGCCCGGGGCACCGGAGG + Intergenic
924289721 1:242524713-242524735 TCCCGGGGCGGCGGCGGCGGCGG + Intergenic
924862261 1:247936967-247936989 AACCTGGGCCAAGGCGCCTGTGG - Intergenic
924921086 1:248629727-248629749 TCCCTGGGCTGCAGCGACGGTGG + Intergenic
1064086505 10:12349648-12349670 GACCGCGGCCGCGGCGGCGGCGG + Exonic
1070304950 10:75234470-75234492 TACCGGGGCCGGAGCCCCGGAGG + Intronic
1077164355 11:1128597-1128619 GACCTGGGCCGGGGGGCAGGAGG - Intergenic
1078246219 11:9574538-9574560 GGCCGGGGCCGCGGCGCCGGAGG + Intronic
1078987173 11:16607511-16607533 TACGCCGGCCGCGGCGCTGGGGG - Intronic
1083609265 11:63997433-63997455 TACATGGACCGCGGCGAGGGCGG + Exonic
1083812271 11:65112509-65112531 TAGCAGAGCCGCGGCGCCTGCGG - Exonic
1084310247 11:68312594-68312616 GTCCTGGTCCGCGGCGCCCGAGG + Exonic
1084410975 11:69005738-69005760 TTCCTGGGCCGCGGGGCCCCCGG - Exonic
1085197942 11:74683557-74683579 CGCCTGGGCCGCGGGGGCGGCGG - Intergenic
1085485666 11:76860950-76860972 CGCCTGGGCGGCGGCGGCGGCGG + Exonic
1089262585 11:117232754-117232776 TCCCGGGGGCGCGGCGCGGGAGG + Intronic
1091381885 12:67136-67158 TTCCTGGGCCCTGGCGGCGGCGG - Exonic
1092727683 12:11500722-11500744 TTCCTGGGCCCCGGCGGTGGCGG - Intronic
1094564938 12:31590855-31590877 TTCCCGGGCGGCGGCGGCGGCGG - Exonic
1096102975 12:48980528-48980550 TACCGGCGGCGCGGCCCCGGGGG + Exonic
1100089706 12:90954684-90954706 AACCTGGGCGGCGGTGGCGGCGG - Exonic
1104841469 12:131828080-131828102 AACCCGGGCCTCGGCGCCGTGGG + Intergenic
1107468176 13:40667271-40667293 TGCAGGAGCCGCGGCGCCGGGGG - Intergenic
1112091897 13:96091108-96091130 TCGGGGGGCCGCGGCGCCGGAGG + Exonic
1118607759 14:67515621-67515643 TGCCAGGGCCGCGGCGCAGGTGG + Intronic
1118776498 14:68977510-68977532 GACCTGGGCCGCGGTGCCCAAGG - Intronic
1119500885 14:75126731-75126753 GTCCTGGGCCGCGGCGCCTTCGG - Exonic
1119821035 14:77616445-77616467 TACCTGGCCGGCGGCGGCTGCGG + Exonic
1121012923 14:90532702-90532724 TACCTGGGCTGGGGAGCTGGTGG - Exonic
1122145175 14:99684517-99684539 CACCTGGGCCGCGGCGGCCCGGG - Exonic
1122445012 14:101761776-101761798 TCCCCGGGCGGCGGCGGCGGCGG + Exonic
1123719602 15:23049394-23049416 TACCTGGCCAGAGGTGCCGGGGG + Intergenic
1123719729 15:23049829-23049851 CACCTGGGCAGAGGTGCCGGGGG + Intergenic
1127267968 15:57376485-57376507 TGCAAGGGCCGCGGCGCCGCCGG - Exonic
1130076691 15:80695620-80695642 CGGCTGGGCCGCGGCGGCGGCGG - Exonic
1131264057 15:90905419-90905441 AAGCTGGGCCGGGGCTCCGGTGG - Exonic
1132566850 16:627500-627522 TCCCTGGCCAGCGGGGCCGGGGG + Exonic
1132719507 16:1308977-1308999 GCCCTGGGCCGGGGCGCGGGCGG - Exonic
1132737795 16:1395641-1395663 TACCTGGGGCGGGGCCCAGGCGG + Intronic
1132828937 16:1918286-1918308 GGCCTGGGCGGCGGGGCCGGGGG - Exonic
1137617702 16:49856948-49856970 CTCCTGGGCAGCGGCGGCGGCGG + Intronic
1137618157 16:49858726-49858748 TCCCTGGGCCGCGGGGGCGTGGG - Intergenic
1139505073 16:67394590-67394612 TAGCTGGGCCGAGAGGCCGGAGG - Exonic
1140209184 16:72957817-72957839 TGCCGGGGCGGCGGCGGCGGCGG - Exonic
1142188597 16:88706579-88706601 TACCTGGGCCGCGGCGCCGGGGG - Exonic
1143223653 17:5282371-5282393 TCTCTGGGCGGCGGCGGCGGCGG + Exonic
1144828841 17:18120931-18120953 CAGCTGGCCTGCGGCGCCGGTGG - Exonic
1146339609 17:32007676-32007698 GACGTGGGCGGCGGCGGCGGCGG - Intergenic
1147571163 17:41571943-41571965 TACTTGAGCCGCAGCGGCGGGGG - Exonic
1147719827 17:42532209-42532231 CACCTGGGCGGCGGCGGCGGCGG - Intergenic
1148566015 17:48633511-48633533 TACCTGGGCGGCGGCGGTGCCGG + Intronic
1149626601 17:58084169-58084191 GACCTGGCCGGCGGCGCGGGCGG + Intronic
1150003658 17:61456657-61456679 TACCTGCTCCGCGGCGGCGGCGG - Exonic
1150407973 17:64919164-64919186 GACGTGGGCGGCGGCGGCGGCGG + Intronic
1150747248 17:67825800-67825822 GACGTGGGCGGCGGCGGCGGTGG - Exonic
1150791895 17:68205762-68205784 GACTTGGGCGGCGGCGGCGGCGG - Intergenic
1152639668 17:81444333-81444355 GAGCTGGGCCTTGGCGCCGGCGG + Intronic
1152659807 17:81537003-81537025 TACCTGCGCGGCGGCGCCTCGGG + Exonic
1152697471 17:81804255-81804277 CACCTGGGCCGCGGCCCCGAGGG + Intronic
1152821592 17:82440298-82440320 TCCCTGGGCCGCCGCGCCTGCGG - Intronic
1154303910 18:13217504-13217526 TACCGGGGCCGCCGTGGCGGGGG - Intronic
1157753081 18:50195196-50195218 CACCTGGGCCTCCGGGCCGGGGG + Intergenic
1157761517 18:50268693-50268715 TACCTAGGCCGCGGGGGCGGGGG - Intronic
1158436028 18:57435921-57435943 CACGCGGGCCGCGGCGCCGCTGG + Exonic
1160859001 19:1229822-1229844 TCCTTGGGCCGCGGCGCGGGCGG + Exonic
1160967596 19:1753470-1753492 GACCCGGGCCCGGGCGCCGGCGG + Exonic
1161208223 19:3053351-3053373 TACCTGGGACCCGGGGTCGGGGG + Exonic
1162003025 19:7760119-7760141 TACCTGTGCCTCGGCCCCTGGGG + Intergenic
1163290610 19:16376970-16376992 GACCTGGGCAGCTGGGCCGGGGG + Intronic
1163607084 19:18281426-18281448 GGCCTGGGCGGCGGCGCCAGTGG - Exonic
1163666503 19:18606304-18606326 TACCTGGGCAGCTGGGCCGAGGG - Intronic
1163807052 19:19405826-19405848 TATCTGGCCGGCGGCGCGGGCGG + Intronic
1166802814 19:45468693-45468715 TACCTGGGAGGCGGCGGCGGTGG - Exonic
1166807695 19:45496979-45497001 CACCAGGGCGGCGGCGGCGGCGG - Exonic
1167377498 19:49119699-49119721 TGCCTGGTCCGCGGCGGCTGCGG - Exonic
1167578329 19:50328316-50328338 GACGCGGGCGGCGGCGCCGGGGG - Exonic
1168344535 19:55643842-55643864 TACCTGGGCCGGGGCGGGAGTGG + Intronic
1168351027 19:55675489-55675511 GGCCTGGGCCGCGGCGCGCGCGG + Intronic
1168403050 19:56097104-56097126 TGCCTGGGCCGTGGAGCTGGGGG - Intronic
925917813 2:8619303-8619325 TCCCTGGGCCCCGGGGCGGGGGG - Intergenic
927506589 2:23619056-23619078 TCCCTGGGCCGAGGGGCCTGTGG - Intronic
929604301 2:43225043-43225065 AACTTGGGCCGCGGCTCCCGCGG + Exonic
934261194 2:91478107-91478129 CACCGGGGCGGCGGCGGCGGCGG - Intergenic
934296818 2:91749024-91749046 TGGCCGGGCCGCGGCGGCGGCGG - Intergenic
937907026 2:127057445-127057467 GAGCTGGGCCGCGGCGGCCGCGG + Intronic
942450898 2:176107578-176107600 TACCGCGGCGGCGGCGGCGGCGG + Exonic
943669874 2:190649120-190649142 TCGCTTGGCCGCGGCGGCGGCGG - Intronic
948874833 2:240820756-240820778 TGTCGGGGCCGGGGCGCCGGGGG + Intergenic
1173672871 20:44810290-44810312 CGCCTCGGCCGCGGCGGCGGCGG + Intronic
1175994177 20:62805001-62805023 GAGCTGGGCCGCGCCGCCCGCGG - Exonic
1176124281 20:63468562-63468584 CGCCTGGGCCCCGGCACCGGGGG + Intronic
1176283317 20:64327697-64327719 TTCCTGGGCCCTGGCGGCGGCGG + Intergenic
1176566762 21:8392107-8392129 CCCCTGCGCCGCGCCGCCGGCGG + Intergenic
1176727116 21:10447297-10447319 TACCTGGGTGGAGGCTCCGGGGG + Intergenic
1178534967 21:33403593-33403615 TGGCGGGGCCGCGGCGGCGGCGG - Exonic
1180287273 22:10759744-10759766 TACCTGGGTGGAGGCTCCGGGGG - Intergenic
1181057709 22:20267888-20267910 TCCCGGGGCCGGGGCGCCAGCGG + Intronic
1182475554 22:30574673-30574695 TCCATTGGCCCCGGCGCCGGAGG - Intergenic
1182621482 22:31620993-31621015 GACCTGGGAAGTGGCGCCGGTGG + Exonic
1182903909 22:33920605-33920627 GGCCTGGGGCGCGGGGCCGGGGG + Intronic
1183247211 22:36703229-36703251 TGCCCGGGCAGCGGCGGCGGCGG + Exonic
1185179795 22:49352791-49352813 TGCCTGGGACGCGATGCCGGGGG - Intergenic
950610596 3:14124541-14124563 CACCTGGGCCGCGCCTCAGGTGG + Intronic
954701983 3:52455401-52455423 TACCTGCGTGGCGCCGCCGGCGG - Intronic
956229596 3:66998575-66998597 CTCCTGGGGCGCAGCGCCGGCGG - Intronic
961698867 3:128726340-128726362 TACCGCGGCCGCTGCGCTGGGGG - Exonic
961827258 3:129605654-129605676 TGCCTGCCCCACGGCGCCGGCGG - Exonic
966762049 3:183427704-183427726 TCCCTGGGGCGCGCCGCTGGTGG - Intronic
967930430 3:194686784-194686806 CAGCTGGGCGGCGGCGGCGGCGG - Exonic
968659639 4:1793709-1793731 GCCCTGGGCGGCGGCGGCGGCGG + Intronic
969912260 4:10457379-10457401 TACAGCGGGCGCGGCGCCGGCGG - Intronic
970333007 4:15003718-15003740 CACCCGGGCGGCGGCGGCGGCGG + Exonic
970456241 4:16226634-16226656 TACCGTGGCGGCGGCGGCGGCGG - Intronic
973137313 4:46724418-46724440 TCGCTGGGCCGCGGCGGCGGCGG + Intergenic
974009298 4:56592688-56592710 CTCCTGGGCCGCGGGGTCGGGGG + Intronic
982042290 4:151408664-151408686 GAGCTGGGCCGGGGCGCCGGTGG + Intergenic
984639265 4:182144531-182144553 TCCCCGGGCCGCGCGGCCGGGGG + Intronic
985725713 5:1514879-1514901 TCCCTGGGCCACAGCTCCGGAGG - Intronic
988468492 5:31514034-31514056 TGCCAGGGCCGGGGCGCCTGTGG - Intronic
992105823 5:73448362-73448384 TAGCTGTGGCGCGGCGGCGGCGG + Exonic
998150774 5:139756330-139756352 AGCCGGGGCCGCGGCGCTGGAGG + Intergenic
1001109699 5:168885466-168885488 GACCTGGGCCCCTGCTCCGGAGG - Intronic
1002105408 5:176877367-176877389 TGCCTGGCCCGAGGCGGCGGGGG + Intronic
1003099032 6:3163112-3163134 TCCAGGGGCCGCGGCGCAGGGGG + Intergenic
1005623988 6:27646243-27646265 GACCTGGGCTGAGGCGCAGGTGG - Intergenic
1006814271 6:36839889-36839911 TCCCTGGGTCTTGGCGCCGGCGG + Exonic
1007594567 6:43043538-43043560 AAGCTGGGCCGCGGCTCTGGGGG + Exonic
1019927766 7:4204682-4204704 CTCCTGGGCCGCAGCCCCGGCGG + Intronic
1020238527 7:6374704-6374726 TCGCTGGGCCGCGGCGGCGGCGG - Exonic
1022363265 7:29684660-29684682 TCCTTCGGCCGGGGCGCCGGGGG - Intergenic
1023703060 7:42911772-42911794 TCCCTGAGCCGCGGCGCTGGCGG - Intronic
1025207894 7:57004007-57004029 GACGGGGGCTGCGGCGCCGGGGG + Intergenic
1026806927 7:73434560-73434582 GACCTGGGCCCGGGCGCGGGCGG + Exonic
1031051881 7:116953438-116953460 CGCCCGGGCCGCGGCGGCGGCGG + Exonic
1035553014 8:544653-544675 CGCCTGGGCGGCGGCGGCGGCGG + Exonic
1036789503 8:11708674-11708696 TTCCCGGGCCGCGGCAGCGGCGG - Exonic
1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG + Exonic
1038152655 8:24956532-24956554 TCCCCGGCCCGCGGCGGCGGTGG + Exonic
1041689913 8:60678755-60678777 TGCTGGGGCCGCGGCGGCGGCGG + Intergenic
1042040218 8:64581385-64581407 GGCCTGGGCGGCGGCGGCGGCGG + Exonic
1044229539 8:89758127-89758149 TACCTGAGCCGCGGCGCCTCTGG + Exonic
1045118741 8:99012975-99012997 TGCTGGGGCCGCTGCGCCGGCGG - Intergenic
1050537784 9:6645447-6645469 CGCCTGGGCCGCGGGGTCGGGGG - Exonic
1051206375 9:14693315-14693337 GGCCTGGGCGGCGGCGCCGGAGG - Exonic
1057432231 9:95004940-95004962 GGCCTGGGCGGCGGCGCGGGCGG - Intronic
1059176735 9:112175150-112175172 GGCCTGGCCCGCGGCGCCGCGGG - Exonic
1061129808 9:128702628-128702650 TACCCGGGCTTCGGCGCCTGCGG - Exonic
1061144119 9:128787268-128787290 TCCCTGGGGGGCGGCGGCGGCGG + Exonic
1062151915 9:135024052-135024074 GACCTGGGAAGCGGCTCCGGAGG + Intergenic
1187826282 X:23335254-23335276 GACCGCGGCCGCGGCGCTGGCGG - Intronic
1190024571 X:46912217-46912239 CACCTGGAACGCGGCGCCGCGGG + Intergenic
1190984410 X:55488503-55488525 GCCCTGGGCCGCGGTGCGGGTGG + Exonic