ID: 1142189196

View in Genome Browser
Species Human (GRCh38)
Location 16:88709827-88709849
Sequence CTGCTTTTAAAGATGGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 528
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 472}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142189190_1142189196 18 Left 1142189190 16:88709786-88709808 CCCTTTCACCAGTCTCTGGACAG 0: 1
1: 0
2: 1
3: 19
4: 271
Right 1142189196 16:88709827-88709849 CTGCTTTTAAAGATGGAGATTGG 0: 1
1: 0
2: 3
3: 52
4: 472
1142189193_1142189196 10 Left 1142189193 16:88709794-88709816 CCAGTCTCTGGACAGAGCCTGGA 0: 1
1: 1
2: 2
3: 28
4: 236
Right 1142189196 16:88709827-88709849 CTGCTTTTAAAGATGGAGATTGG 0: 1
1: 0
2: 3
3: 52
4: 472
1142189191_1142189196 17 Left 1142189191 16:88709787-88709809 CCTTTCACCAGTCTCTGGACAGA 0: 1
1: 0
2: 0
3: 14
4: 205
Right 1142189196 16:88709827-88709849 CTGCTTTTAAAGATGGAGATTGG 0: 1
1: 0
2: 3
3: 52
4: 472
1142189184_1142189196 28 Left 1142189184 16:88709776-88709798 CCAACCCCGCCCCTTTCACCAGT 0: 1
1: 0
2: 3
3: 11
4: 291
Right 1142189196 16:88709827-88709849 CTGCTTTTAAAGATGGAGATTGG 0: 1
1: 0
2: 3
3: 52
4: 472
1142189186_1142189196 23 Left 1142189186 16:88709781-88709803 CCCGCCCCTTTCACCAGTCTCTG 0: 1
1: 0
2: 1
3: 25
4: 365
Right 1142189196 16:88709827-88709849 CTGCTTTTAAAGATGGAGATTGG 0: 1
1: 0
2: 3
3: 52
4: 472
1142189194_1142189196 -7 Left 1142189194 16:88709811-88709833 CCTGGATGTGAAGATGCTGCTTT 0: 1
1: 0
2: 0
3: 14
4: 221
Right 1142189196 16:88709827-88709849 CTGCTTTTAAAGATGGAGATTGG 0: 1
1: 0
2: 3
3: 52
4: 472
1142189185_1142189196 24 Left 1142189185 16:88709780-88709802 CCCCGCCCCTTTCACCAGTCTCT 0: 1
1: 0
2: 0
3: 20
4: 286
Right 1142189196 16:88709827-88709849 CTGCTTTTAAAGATGGAGATTGG 0: 1
1: 0
2: 3
3: 52
4: 472
1142189187_1142189196 22 Left 1142189187 16:88709782-88709804 CCGCCCCTTTCACCAGTCTCTGG 0: 1
1: 0
2: 3
3: 52
4: 387
Right 1142189196 16:88709827-88709849 CTGCTTTTAAAGATGGAGATTGG 0: 1
1: 0
2: 3
3: 52
4: 472
1142189189_1142189196 19 Left 1142189189 16:88709785-88709807 CCCCTTTCACCAGTCTCTGGACA 0: 1
1: 0
2: 1
3: 19
4: 264
Right 1142189196 16:88709827-88709849 CTGCTTTTAAAGATGGAGATTGG 0: 1
1: 0
2: 3
3: 52
4: 472

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142189196 Original CRISPR CTGCTTTTAAAGATGGAGAT TGG Intronic
900889977 1:5442522-5442544 CTGGCTTTAAAGATGGAGGAGGG + Intergenic
900924621 1:5696527-5696549 CTGTTTTTAAAAATTGAGACAGG - Intergenic
901046252 1:6397621-6397643 CTGTTTTTAAGGATGGCAATGGG + Intergenic
901904358 1:12394842-12394864 CTGCTTTTAATGTTGCAGCTTGG - Intronic
902269468 1:15292916-15292938 TTTCTTTTAAAAATAGAGATGGG - Intronic
902785549 1:18730702-18730724 CTACTTTAAAAGAAGGGGATGGG - Intronic
903515025 1:23904505-23904527 TTTCTTTGAAAGAGGGAGATAGG - Intronic
903571185 1:24306779-24306801 CTTCTTTAAAAAATTGAGATGGG + Intergenic
905134930 1:35791625-35791647 CTTCTTTTAAAGATGTTGCTGGG - Intergenic
905473162 1:38207976-38207998 CTGCTTTCAGAGAAGGACATAGG - Intergenic
905878290 1:41447550-41447572 ATGTTCTTAAAAATGGAGATGGG + Intergenic
906683718 1:47749010-47749032 ATTCTTTGAAAGATGGAGTTGGG + Intergenic
907396442 1:54193661-54193683 CTTTTTATAAAGATAGAGATGGG - Intronic
907798478 1:57740958-57740980 TTGGTTTTAAAGATTGAGGTGGG + Intronic
908082436 1:60595689-60595711 CTGACTTTAAAGATGGAGAGAGG - Intergenic
908449829 1:64241937-64241959 TTGCTGCCAAAGATGGAGATAGG + Intronic
908661291 1:66438264-66438286 CTGCTATTATAGATGCAGTTAGG - Intergenic
908758079 1:67487222-67487244 CTTTTTTTAAAAATAGAGATGGG + Intergenic
909434662 1:75627052-75627074 GGACTTTAAAAGATGGAGATGGG - Intergenic
909532471 1:76696316-76696338 CTGCTTTTAAAGATTTATTTAGG - Intergenic
909554180 1:76934407-76934429 CAGCTTTTCTAGAAGGAGATAGG - Intronic
909797751 1:79764355-79764377 ATGCTTTTATAACTGGAGATTGG - Intergenic
910205272 1:84743286-84743308 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
911026034 1:93435969-93435991 CTGGCTTTAAAGATGGAGGATGG - Intergenic
911684571 1:100760176-100760198 CACATTTTAAAGATGGAGACAGG + Intergenic
911743244 1:101410828-101410850 TTGCTTTTACAGCTGGAGATTGG + Intergenic
912088531 1:106040826-106040848 CTGGTTTTAAAAATGAAAATTGG - Intergenic
912465638 1:109871579-109871601 CTGGTTTTGAAGACGGAGAAAGG + Intergenic
912708641 1:111933666-111933688 CAGCTTTGAAAGGTGGAGCTTGG - Intronic
914901158 1:151711826-151711848 TTGCTGTTCTAGATGGAGATGGG + Intronic
915289121 1:154870946-154870968 CTCCTTTTACAGATGAAAATTGG + Intergenic
915561061 1:156688356-156688378 ATGTTTTTAAAAATAGAGATAGG + Intergenic
916215016 1:162386665-162386687 CAGCGTTTAAAGAAGAAGATTGG + Intronic
916930757 1:169576014-169576036 CTGGTTTTGAAGATGGAGGAAGG + Intronic
917379516 1:174389495-174389517 CTACTTTTAAAGATGTCTATTGG - Intronic
919139293 1:193550612-193550634 ATTCTTTTAAAGAAGGGGATTGG + Intergenic
919538552 1:198819686-198819708 CTGGTTTTGAAGATGAAGAAAGG - Intergenic
919662108 1:200257388-200257410 CTGGCTTTGAAGATGGAGAACGG + Intergenic
919925370 1:202189214-202189236 CTGCTTCTGGAGATGGACATAGG - Intergenic
920991430 1:210943650-210943672 CTGCTTAAAAAGAAGGAGAGAGG - Intronic
921589730 1:216989273-216989295 ATTTTTTTAGAGATGGAGATGGG - Intronic
923195698 1:231664593-231664615 CTGCTTTTGAAGATGGAGAAAGG + Intronic
923488025 1:234455018-234455040 CTGGTTTTGAAGATGGAGAAAGG + Intronic
1063685869 10:8236722-8236744 GTGCTTTTAAAGTCTGAGATAGG - Intergenic
1065783697 10:29193616-29193638 CTGCTTTTGATGCTGGAGCTGGG - Intergenic
1066008400 10:31169699-31169721 CTGTTTTTAAATTTAGAGATAGG - Intergenic
1066433525 10:35375324-35375346 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1067372579 10:45699230-45699252 TTGCTTTTAGAGCTGGAGATGGG - Intergenic
1067387200 10:45826894-45826916 TTGCTTTTAGAGGTGGAGATGGG + Exonic
1067418929 10:46130357-46130379 TCGCTTTTAGAGCTGGAGATGGG - Intergenic
1067447077 10:46357713-46357735 TTGCTTTTAGAGCTGGAGATGGG - Intergenic
1067504281 10:46836946-46836968 TTGCTTTTAGAGCTGGAGATGGG - Intergenic
1067522697 10:47020247-47020269 CTCATTTCAAAGATGGACATGGG + Intergenic
1067590306 10:47503047-47503069 TTGCTTTTAGAGCTGGAGATGGG + Exonic
1067637426 10:48011149-48011171 TTGCTTTTAGAGCTGGAGATGGG + Intergenic
1067797385 10:49330601-49330623 AAGCTTGTGAAGATGGAGATAGG - Intergenic
1067876063 10:50009185-50009207 TTGCTTTTAGAGCTGGAGATGGG - Exonic
1067921599 10:50464315-50464337 CTGACTTTAAAGATGGAAAAGGG + Intronic
1068148642 10:53103254-53103276 CTGTCTTTAAGGATAGAGATGGG + Intergenic
1068307050 10:55224906-55224928 CTGCTTTTCAAGATGAGAATAGG - Intronic
1068610762 10:59057480-59057502 ATGCTTTTTCAGATGGAGATTGG + Intergenic
1069845729 10:71369894-71369916 CTGCCTTAAAAGATTGAGAAGGG + Intergenic
1070134023 10:73675578-73675600 TTGCTTTTAGAGCTGGAGATGGG + Exonic
1071076579 10:81761036-81761058 CTGCTTTTAGAAATTGGGATTGG + Intergenic
1071607687 10:87008829-87008851 TTGCTTTTAGAGCTGGAGATGGG - Intergenic
1071927603 10:90428572-90428594 CTGGTTTTAAAGATGGGCAAAGG - Intergenic
1071966319 10:90856932-90856954 TTTCTTTTAAAGATGTACATAGG + Intronic
1072310276 10:94147657-94147679 AATCTGTTAAAGATGGAGATGGG + Intronic
1072760460 10:98052109-98052131 ATGCTTTGAAAGAAGGAAATGGG - Intergenic
1073604363 10:104879334-104879356 TTGCCTTTGAAGATGGAGACAGG - Intronic
1074081806 10:110173887-110173909 CTGTCTTTAAAGAAAGAGATTGG + Intergenic
1074386397 10:113019999-113020021 CTGCTTTTAAAGAAGGGCAAAGG - Intronic
1075029117 10:119009321-119009343 CTGGCTTTGAAGATGGAGTTGGG + Intergenic
1075482390 10:122793215-122793237 CTGCTTTTAAAAATGTAAAATGG + Intergenic
1076927703 10:133501396-133501418 CTGCTTTTAATGTTGCAGCTTGG - Intergenic
1077290301 11:1786636-1786658 CTGGCTTTGAAGATGGAGGTGGG - Intergenic
1079641722 11:22813976-22813998 CTGATTTTGAAGATGGAGGAAGG - Intronic
1079858805 11:25641714-25641736 CTCCTGTTAAAGCTGGAGAATGG - Intergenic
1081533058 11:43977444-43977466 CTGGCTTTAAAGATGGTGAGAGG + Intergenic
1081855739 11:46302349-46302371 TTGCTTTAAAGGATGGAGTTAGG - Intronic
1085404595 11:76254477-76254499 CTGCCTTTAAAGCTGCAGAGAGG - Intergenic
1086140687 11:83495578-83495600 CTGCTATTAAAGAGGAAGATTGG + Intronic
1086244848 11:84740256-84740278 CTGCTTGGAAGGAGGGAGATGGG - Intronic
1087754624 11:102042052-102042074 ATGCTTTTAAAGATATAAATAGG - Intergenic
1088189301 11:107209699-107209721 CTGCCTTTAAGGAGTGAGATGGG - Intergenic
1088191969 11:107236685-107236707 CTGCATTTAAGGTTGGAGCTTGG - Intergenic
1088264864 11:107979367-107979389 CTGCTTTTAATGTTGCAGCTTGG + Intergenic
1088266976 11:107997241-107997263 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1090461219 11:126893215-126893237 CTTCTTTTAAAAATAGTGATGGG + Intronic
1091424790 12:378077-378099 CTACTGTTAAAGATGGAGAATGG - Intronic
1091949310 12:4580016-4580038 CTCATTTTACAGATGGAGAAAGG - Intronic
1092380994 12:7997012-7997034 CTGCTTTTAATGTTGCAGCTCGG + Intergenic
1093516335 12:19990874-19990896 CTGGTTTTGAAGATGGAGAAAGG + Intergenic
1093566423 12:20610439-20610461 CTGCTGTTAGAAATGTAGATTGG + Intronic
1093634974 12:21455517-21455539 CTGTTTGCAAAGATGCAGATGGG - Intronic
1093719186 12:22418678-22418700 CTGGTTTTGAAGATGGAGGGAGG + Intronic
1094079839 12:26521718-26521740 CATCTTTTAAAGACGCAGATAGG + Intronic
1094793488 12:33942275-33942297 CTGACTTTAAAGATGTAGAATGG + Intergenic
1095104762 12:38219026-38219048 CTGACTTTAAAGATGTAGAATGG + Intergenic
1095849910 12:46791239-46791261 CTGCTTTTCAAGGATGAGATGGG - Intronic
1096021148 12:48326614-48326636 CTGATTTTAAAGATGGGAAAAGG + Intergenic
1096724918 12:53553753-53553775 TTGCTTCTAAAAATGGTGATTGG + Intronic
1097273234 12:57792374-57792396 TTTCTTTTAAATATAGAGATGGG - Intronic
1097612122 12:61836624-61836646 CTGCTTTCAAAGAAGCAGTTTGG - Intronic
1098380774 12:69867256-69867278 CTGCTTTGAGAGGGGGAGATTGG + Intronic
1098715766 12:73827268-73827290 CTGCTTTTAATGTTGCAGCTAGG + Intergenic
1099016437 12:77348942-77348964 CTGGTTTTAAAGATGGAAGAAGG - Intergenic
1099610347 12:84859908-84859930 TTGCCTTTAAAGATGGAGAATGG + Exonic
1100316814 12:93452356-93452378 TTTTTTTTAAAGATAGAGATGGG + Intergenic
1100347258 12:93744354-93744376 CTGCCTTTGAAGATGTAGATGGG - Intronic
1100588699 12:96003769-96003791 CTCCTTTGAAAGATGGAGAAAGG - Intronic
1101410608 12:104464669-104464691 CTGCTTTAAAAATTGGAAATGGG - Intronic
1102185821 12:110947868-110947890 CTGCCTTTGAAGATGGAGGAAGG - Intergenic
1103015693 12:117492841-117492863 CTGACTTTGAAGATGGAGAAGGG + Intronic
1104218321 12:126756873-126756895 CTGCCTTTGATGATGGAGAAAGG - Intergenic
1104482634 12:129121562-129121584 CTGGATTTGAAGATGGAGAATGG + Intronic
1105831421 13:24165590-24165612 CTGCTGCTAAAGTTGGAGTTGGG - Intronic
1106324223 13:28672596-28672618 CTGTTTTTAAAAGTGAAGATTGG + Intronic
1107536252 13:41337088-41337110 ATGCTTTTAAAGTTAGAGCTTGG + Intronic
1108557551 13:51609816-51609838 TAGCTTTTAAAGATAAAGATGGG - Intronic
1108667185 13:52644470-52644492 CAGCTTTTATAGAGGGAGACTGG + Intergenic
1109211426 13:59539512-59539534 ATGGTCTTAAATATGGAGATTGG + Intergenic
1110068026 13:71133533-71133555 CTGGTTTTCAAGATGGAGGTAGG + Intergenic
1110721089 13:78762871-78762893 CTGCTGTGAAAGCTGGAGACTGG + Intergenic
1112154165 13:96799059-96799081 CTGTATTTAGATATGGAGATAGG - Intronic
1112305576 13:98270420-98270442 CTGGTTTTAAATGTGGACATGGG + Intronic
1112669609 13:101619424-101619446 CTGCCTTTGAAGATGGAGAAAGG + Intronic
1113332360 13:109342109-109342131 CTGGTTTTAAAGGTGGAGGGAGG + Intergenic
1113343975 13:109455713-109455735 CTGGCTTTCAAGATGGAGAAAGG - Intergenic
1114161956 14:20178187-20178209 CTTCTTAAAAAGATTGAGATAGG - Intergenic
1116044901 14:39732488-39732510 GTGCTGTTAAAGATATAGATGGG + Intergenic
1116511070 14:45747463-45747485 TTGCCTTGAAACATGGAGATAGG + Intergenic
1116802307 14:49455553-49455575 TTGGCTTTAAAGATGGAGAAAGG + Intergenic
1117167769 14:53056466-53056488 TTATTTTTTAAGATGGAGATGGG + Intronic
1117319705 14:54609268-54609290 CTGACTTCAAAGATGGAGAAAGG + Intronic
1117835272 14:59798530-59798552 CTGGCTTTGAAGATGGAGAATGG - Intronic
1117928237 14:60808018-60808040 ATGCTTTTAAAGCTAGAGAGGGG + Intronic
1118070692 14:62244035-62244057 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1118270933 14:64341439-64341461 CTAGTTTTAAAGATGGAGGAAGG + Intergenic
1119059991 14:71464332-71464354 CTGCTTTTAATGTTGCAGCTCGG - Intronic
1119206255 14:72796200-72796222 CTCCTTTTATAGATGGGGAAAGG - Intronic
1119505759 14:75171579-75171601 CTGGCTTTAAAGATGGAGGAAGG + Intronic
1120057346 14:79939964-79939986 TTGCTTTTAAAAATAGATATAGG + Intergenic
1120275415 14:82367256-82367278 CTGCTTTAAAAGACGGTGCTAGG - Intergenic
1120550303 14:85863164-85863186 TTGCTTTTAAAAAGGGATATGGG - Intergenic
1121204896 14:92155756-92155778 TTTTTTTTAAAGATAGAGATGGG - Intronic
1122327279 14:100890382-100890404 CTGATTTTAAAAATAGAGCTTGG + Intergenic
1123920424 15:25066022-25066044 CTGCTTTCAAAGCGGGAAATGGG - Intergenic
1125708591 15:41764713-41764735 TTTCTTGTAGAGATGGAGATGGG + Intronic
1125738648 15:41945947-41945969 CTGCTTATAAAGGAGGAGACTGG - Intronic
1126221421 15:46218632-46218654 TTGCTTTTCTAGATGGAGAGAGG + Intergenic
1126449449 15:48789720-48789742 CTGGCTTTGAAGATGGAAATGGG + Intronic
1127925927 15:63541569-63541591 CTGCTTTTAACAAAGGATATGGG + Intronic
1129459290 15:75692289-75692311 TTTCTTTTAAAAATAGAGATGGG + Intronic
1129994149 15:79990438-79990460 CTGTTGTGGAAGATGGAGATGGG - Intergenic
1130387491 15:83424354-83424376 ATGATCTGAAAGATGGAGATTGG - Intergenic
1130712094 15:86293416-86293438 CTGGCTTTGAAGATGGAGAAAGG - Intronic
1131062425 15:89412056-89412078 CTGCTATTAAAGAGGGTGTTTGG - Intergenic
1131532690 15:93207129-93207151 CTGCTTTCAGAGTTGGAGAGGGG + Intergenic
1131640726 15:94289983-94290005 CTGGCTTTGAAGATGGAGAAAGG + Intronic
1132497057 16:268915-268937 CTGGTTTTAGAGATGGGGATGGG + Exonic
1132505409 16:305853-305875 CTTTTTTTAAAAATAGAGATGGG + Intronic
1133384192 16:5355510-5355532 CTGGGTTTAAAAATGGAGACTGG + Intergenic
1133625798 16:7569395-7569417 CTGATTTTGAAGATGGGGAAAGG - Intronic
1134795521 16:17032117-17032139 CTGCTAATAAAGATGGAGAGAGG - Intergenic
1134872775 16:17666824-17666846 CTGGCTTTGAAGATGGAGAAAGG - Intergenic
1135241757 16:20813372-20813394 CTGGTTTGAATGATGGAGCTTGG - Intronic
1135940816 16:26820117-26820139 CTCCTTTTACAGATGGGGAAAGG - Intergenic
1137366844 16:47867017-47867039 GTGCTTTTAAAGAGGAAGACAGG + Intergenic
1137601915 16:49762110-49762132 CAGCTTTTAAATATGGATTTGGG - Intronic
1137946869 16:52741628-52741650 CTGCTTTTTATTATGCAGATTGG - Intergenic
1139057141 16:63199489-63199511 CTGACTTTGAAGATGGAGAGAGG + Intergenic
1139770518 16:69271914-69271936 TTGGTACTAAAGATGGAGATGGG + Intronic
1140937879 16:79691563-79691585 CTAGTTTTCAAGATGGAGAAAGG + Intergenic
1141471933 16:84244671-84244693 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1141622681 16:85245280-85245302 CTGCTATTAAAGCTGGAGATTGG + Intergenic
1142189196 16:88709827-88709849 CTGCTTTTAAAGATGGAGATTGG + Intronic
1142338218 16:89503999-89504021 CTTCTTTAAAAGATGGGGCTGGG - Intronic
1143348193 17:6265908-6265930 CTGCCTTTGAAGATGGAGGAAGG - Intergenic
1143873018 17:9971223-9971245 CTATTTTTAAAAATAGAGATGGG - Intronic
1144223725 17:13123927-13123949 CTTCTTTCAAATTTGGAGATTGG - Intergenic
1144342806 17:14324155-14324177 CTGTTTTTACACATGGAGACAGG + Intronic
1145931902 17:28692010-28692032 CTTTTTTTAAAAAAGGAGATGGG - Intronic
1146533272 17:33628594-33628616 CTGCTTTTAAAAAGCCAGATAGG - Intronic
1146836218 17:36112990-36113012 CTGCATTTAATGTTGCAGATTGG + Intergenic
1149306643 17:55354031-55354053 TAGCTCTCAAAGATGGAGATAGG + Intergenic
1149983921 17:61332914-61332936 CTCCTTTTTAAGATGGGGATAGG - Intronic
1150337800 17:64343097-64343119 CTCCTTTTACAGATGGGGAAAGG + Intronic
1150376872 17:64688733-64688755 TTGTTTTTAGAGATGGAGTTTGG - Intergenic
1152658789 17:81532902-81532924 CTGCTTCTAAAGTGGGAGATGGG - Intronic
1153169633 18:2301166-2301188 CTGCCTTTCAAGATGGAGGAAGG + Intergenic
1154082175 18:11268384-11268406 CTGCTTTTACAGGGGAAGATAGG - Intergenic
1155828999 18:30488070-30488092 TTGCTTTAAAAAATAGAGATGGG + Intergenic
1156695582 18:39762241-39762263 CTGACTTTGAAGATGGAGAAGGG - Intergenic
1157015416 18:43706608-43706630 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1157179817 18:45487227-45487249 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1157525942 18:48382264-48382286 TAGCTTCTGAAGATGGAGATAGG + Intronic
1158188045 18:54793872-54793894 CTATTTTTAAAAATAGAGATGGG - Intronic
1161845830 19:6711458-6711480 CTGCCTTTAAAGGTGGAGGAAGG + Intronic
1161996801 19:7718070-7718092 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1162877068 19:13628298-13628320 CTCCTTTTAAAAATAGAGACAGG - Intergenic
1162919791 19:13893959-13893981 CTGCTTTGAAAGAGTGGGATGGG + Intronic
1163881379 19:19925221-19925243 ATGCTGTTAAAGCTGAAGATTGG - Intronic
1164860060 19:31555638-31555660 CTGGTTCTAAAGATGCAGAGAGG - Intergenic
1165479319 19:36053049-36053071 TTGTTTTTAAAGAGAGAGATGGG - Intronic
1165571992 19:36783173-36783195 TTGTTTTTAAAAATAGAGATGGG + Intergenic
1165680722 19:37772431-37772453 TTTTTTTTAAATATGGAGATTGG - Intronic
1165712604 19:38022901-38022923 CTTCTTGTAAAGATGAAGAGAGG - Intronic
1166400993 19:42479897-42479919 CTGGTTTCAAAGATGGAAAAGGG - Intergenic
1166593986 19:44028104-44028126 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1166599654 19:44082721-44082743 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1166601753 19:44101859-44101881 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1166603571 19:44119498-44119520 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1167424985 19:49425607-49425629 CTGTTATTGAAGATGGAGCTAGG - Intronic
1167639753 19:50674335-50674357 CTGGTCTCAAAGATGGAGAAGGG - Intronic
925513734 2:4656542-4656564 CTGCTTTGTGATATGGAGATGGG - Intergenic
926192861 2:10741609-10741631 CTGCTTTCACGGATGGAGACTGG + Intronic
926214661 2:10897235-10897257 CTCCCTCTGAAGATGGAGATGGG + Intergenic
926462232 2:13145252-13145274 CTGTTTTTAAAGAGGGACTTGGG + Intergenic
926889151 2:17624622-17624644 CTGCTTTTGAAGAAGGAGGAAGG + Intronic
926951283 2:18246138-18246160 CTGCTTGTAATGAAGGACATGGG - Intronic
928480407 2:31677039-31677061 CTTATTTTACAGATGAAGATAGG - Intergenic
930092166 2:47539041-47539063 CAGCTATTAAAGATGTTGATGGG - Intronic
930401087 2:50889118-50889140 CGGTTTTGAAACATGGAGATTGG + Intronic
931040815 2:58297515-58297537 CTGATTTTGAAAATGGAGACTGG - Intergenic
931943169 2:67275647-67275669 TTGTTTTTAAAGATGGTGAGTGG - Intergenic
932512730 2:72311425-72311447 CTGGTTTTGAAGATGGAGGAAGG - Intronic
933599209 2:84312775-84312797 CTGATTTTAAAGCTACAGATAGG + Intergenic
933990470 2:87630269-87630291 CTGCTTTCAAAGAGGGTGAAAGG - Intergenic
936493828 2:112999847-112999869 CTGCTTTTACATATGAAGATAGG - Intergenic
937519737 2:122697741-122697763 CTGGCTTTGAAGATGGAGATAGG - Intergenic
937642190 2:124226268-124226290 CTCTTTATAAAGAAGGAGATAGG - Intronic
937966962 2:127519889-127519911 CTGGTTTTGAAGATGGAGGAAGG + Intronic
938365980 2:130734665-130734687 CTGGCTTTGAAGATGGAGAAGGG + Intergenic
939078419 2:137630294-137630316 CTGTTTTTAAAGTTTGAGATTGG - Intronic
939619217 2:144397939-144397961 GTGCTTTTAAAGATGTACACAGG - Intronic
939785200 2:146501144-146501166 CTTCTTTCAAAGAAAGAGATAGG + Intergenic
940027457 2:149223617-149223639 CTGCTTCTCAAGATGTTGATGGG + Intergenic
940307609 2:152243368-152243390 CTTCTTTTAAAGAGGGAGACTGG - Intergenic
940472417 2:154115744-154115766 CTGCATTTAATGTTGCAGATCGG - Intronic
940757660 2:157701592-157701614 CTCCTTTTAAAGATATAGAATGG + Intergenic
940986322 2:160055706-160055728 CTTCTTTTACAGATGAAGAAGGG - Intronic
941140310 2:161772412-161772434 TTGATTTTAAAGATGGTGAATGG + Intronic
941614842 2:167707559-167707581 CTGGTTTTCAAGATGGAGAAAGG - Intergenic
941620345 2:167770918-167770940 CTGCTATCGAAAATGGAGATAGG - Intergenic
942826152 2:180179335-180179357 CAACTTTTAAAGATGAAGACAGG - Intergenic
943231380 2:185257221-185257243 CTGCTTATAAATACGGCGATTGG + Intergenic
943509194 2:188803107-188803129 CTGCTTTTAATGTTGCAGCTTGG + Intergenic
943759458 2:191592521-191592543 CTGGCTTTAAAGATGGAGCAAGG - Intergenic
944798600 2:203212811-203212833 CTTCTTTTGGAGATGGAGGTAGG + Intronic
945402672 2:209405279-209405301 CTGGTTTTAAAGATTGATAAAGG + Intergenic
945641884 2:212441664-212441686 CTGCTTTTAATGTTGCAGCTTGG + Intronic
945846945 2:214956989-214957011 TATCTGTTAAAGATGGAGATTGG - Intronic
946809437 2:223507967-223507989 TTGCTATTAATGATGGGGATTGG + Intergenic
947017327 2:225635730-225635752 CTGCATTTATAGATGGAATTTGG + Intronic
947214999 2:227742264-227742286 TGCCTTTTAAAAATGGAGATGGG - Intergenic
947282386 2:228469769-228469791 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
947337438 2:229102051-229102073 CTGGCTTTGAAGATGGAGAATGG + Intronic
948373245 2:237504002-237504024 CTGGTTTTGAAGATGGAGAAAGG + Intronic
1168891259 20:1296530-1296552 CTCATTTTAAAGATGGGAATGGG - Intronic
1170143724 20:13150482-13150504 CTGGTTTTAAAGAAAGAGATAGG - Intronic
1170238813 20:14139331-14139353 CTCCTTTTATAGATGAAGAAAGG + Intronic
1170238973 20:14141401-14141423 CTCCTTTTATAGATGAAGAAAGG - Intronic
1172480936 20:35271027-35271049 CTTTTTTTTAAGATGGAGTTTGG - Intronic
1172769661 20:37373733-37373755 ATGATTTTTAAGATGGAGCTAGG - Intronic
1172870723 20:38134024-38134046 CTACTGCTAAAGAGGGAGATTGG + Intronic
1173484894 20:43433722-43433744 CTGCTTCTAAAGAGTGAGAAGGG + Intergenic
1173496623 20:43523730-43523752 CTTTTTTTAAAGATAGAAATAGG + Intronic
1173646594 20:44637104-44637126 CTGCTTTTGAAAATGGAGCCTGG - Intronic
1174093645 20:48069972-48069994 TTGCTTCAAAAGATGGAAATTGG + Intergenic
1174136441 20:48383228-48383250 CTGCTGTTAACCATGGAGCTGGG + Intergenic
1174229826 20:49037417-49037439 CTTTTTTTAAAAATAGAGATGGG + Intergenic
1174302987 20:49595614-49595636 CTGGCTTTGAAGATGGAGGTTGG - Intergenic
1174465674 20:50715369-50715391 CTGATTTTAAAGATGGAGGTGGG + Intergenic
1174645402 20:52081038-52081060 CTGCATTTAAAGAGGGACAGGGG + Intronic
1178725509 21:35048018-35048040 CTGGTTTCAAAAATGGAGACAGG + Intronic
1179169462 21:38961804-38961826 CTGCCTTTAAAGATGGACGAAGG - Intergenic
1182000984 22:26919619-26919641 CTGGCTTTGAAGATGGAGAAGGG + Intergenic
1182229395 22:28825654-28825676 CTTTTTTTAAAAATAGAGATGGG - Intergenic
1182614608 22:31578527-31578549 CTGCATTTAATGAAGGTGATAGG - Intronic
1182794893 22:32984745-32984767 CTTCTTTTAAATTTGGAGCTTGG - Intronic
1182942741 22:34293427-34293449 CTGCTATTTAAAATGGAGTTGGG + Intergenic
949135149 3:555336-555358 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
949187099 3:1205119-1205141 CTGATTTTAAAGATAGAGAAAGG + Intronic
949587957 3:5461470-5461492 ATGCTTTTAGAGATGGGGGTGGG - Intergenic
950941083 3:16892248-16892270 CTTCATTTAAAGATGGATCTAGG + Intronic
951215996 3:20025787-20025809 CTGCTTTCAAATCAGGAGATGGG + Intergenic
951736233 3:25868109-25868131 CTGCTTTTAAAAAAGGGCATAGG + Intronic
951971041 3:28444050-28444072 CTGCTTTTAATGTTGCAGCTTGG - Intronic
952483185 3:33783315-33783337 CTGGTTTTAAATATGGATGTAGG + Intergenic
953298718 3:41750192-41750214 CTGCCTTTAATGATGGAGTCTGG + Intronic
953522669 3:43657845-43657867 CTGCTTTCAAAGATGGAATTTGG - Intronic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
955203895 3:56877666-56877688 CAGTTTTTAAAAATTGAGATCGG - Intronic
955278955 3:57575151-57575173 CTTGTTTTAAAAGTGGAGATGGG - Intronic
955485015 3:59426427-59426449 CTGTCTTCAAAGATGGAGAAAGG - Intergenic
955976914 3:64488756-64488778 CTGCTTTTACAGAGGAAGAAAGG - Intergenic
956426515 3:69141048-69141070 CTGCTTTTCAAAATTTAGATTGG - Intergenic
956613066 3:71144083-71144105 CTGCTTTTTAAGAAGTAGTTTGG + Intronic
957032517 3:75258079-75258101 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
957754328 3:84467202-84467224 CTGCTTTTAATGTTGTAGCTTGG + Intergenic
958110072 3:89130936-89130958 CACCATTTAAAAATGGAGATAGG - Intronic
958526053 3:95261157-95261179 TTTCTTTTACAGCTGGAGATGGG + Intergenic
958552531 3:95635624-95635646 CTGCTTTTAAACATGGTTGTAGG - Intergenic
958596455 3:96231617-96231639 CTAGATTTAAAGATGGAGAATGG - Intergenic
960983472 3:123254319-123254341 TTTCTTTTAAAGATGAGGATGGG - Intronic
961636387 3:128335605-128335627 CAGCTTTTACAGAGTGAGATGGG + Intronic
962229365 3:133647661-133647683 TTACTTTTAAAAATAGAGATGGG - Intronic
963372533 3:144419484-144419506 CTGGCTTTGAAGATGGAGAATGG - Intergenic
963526665 3:146423778-146423800 CTGGTTTTAAAGATGGAAGGAGG + Intronic
964220305 3:154336765-154336787 CTGTTTTTAAAGCTGAGGATTGG - Intergenic
964654912 3:159055599-159055621 CTGGCTTTGAAGATGGAGAAGGG - Intronic
965221003 3:165925348-165925370 CTGATTTTGAAGATGGGGAAAGG + Intergenic
965279416 3:166728913-166728935 CTGCTTTAAATGATGAATATAGG - Intergenic
965549956 3:169954351-169954373 CTGCTTGTAACGTTGGAAATGGG - Intergenic
965555938 3:170018468-170018490 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
965636580 3:170788243-170788265 CTGGCTTTGAAGATGGAGAAAGG + Intronic
965832282 3:172806019-172806041 CTGTTCCTAGAGATGGAGATGGG - Intronic
966435976 3:179884395-179884417 CTGCTTTTGAAGATGGAGCAAGG + Intronic
967722375 3:192828958-192828980 CCCCTTTTAAAGATGCAGTTCGG + Intronic
967787676 3:193514936-193514958 CTGATTTTAGTGATGGAAATGGG + Intronic
968004050 3:195227165-195227187 CTGCTTTTGAACATGAAGCTGGG + Intronic
968148043 3:196316013-196316035 CTTTGTTTAAAGATGGAGAGGGG + Intronic
969049853 4:4365038-4365060 CTGCCTTTGAAGATGGAGGAAGG - Intronic
969065305 4:4474706-4474728 CTGGTTTTGAAGATGGGGAAAGG + Intronic
970724792 4:19031052-19031074 CTGTTTTGTAAAATGGAGATGGG + Intergenic
970731405 4:19107932-19107954 CTGGTTTCAAAGATGGAAAGGGG + Intergenic
970743224 4:19263007-19263029 CTACTTTTAAAAATGGAGAAAGG - Intergenic
970774885 4:19661889-19661911 ATGCTTTTAAAGAAGGGGCTGGG + Intergenic
971609076 4:28698526-28698548 CTTCTTTTTAAGCTTGAGATTGG + Intergenic
971649490 4:29254637-29254659 TTGCTTTTAATGATGGGGATGGG - Intergenic
971663820 4:29456341-29456363 CTGTCTTTAAAGATGGAGGAAGG - Intergenic
971842700 4:31874662-31874684 CTGATTTTGAAGATGGAAAAAGG - Intergenic
972046484 4:34671421-34671443 ATATTTTTAAAAATGGAGATAGG + Intergenic
972176592 4:36415322-36415344 TTGCTTTTAAATTTGGAGGTAGG + Intergenic
972761026 4:42104592-42104614 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
973691147 4:53433734-53433756 CTGCTTTTAAAGTTAGCTATAGG + Intronic
974008411 4:56584211-56584233 CTGCCTTGAAAGGTGGAGGTGGG - Intronic
974160642 4:58133658-58133680 CTTATTTTGAAGATGGAGAAAGG + Intergenic
974374402 4:61057947-61057969 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
976004554 4:80413961-80413983 ATGCTTATAAAGATGAACATGGG - Intronic
977361933 4:96016294-96016316 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
977875072 4:102140020-102140042 CTGCTTTCACAGATAGACATAGG + Intergenic
979056669 4:116003556-116003578 CTGCTTTTCAAGTTGGAGGTGGG - Intergenic
979060519 4:116053838-116053860 ATGCTTTTAGAAATGTAGATTGG - Intergenic
979466312 4:121042388-121042410 ATGCTTTTGGAGATGGAGAATGG + Intronic
979801748 4:124918247-124918269 CAGCTTATAAAGATGGATAGTGG - Intergenic
980514120 4:133831501-133831523 CTCCTTTTAAATATTGAAATAGG + Intergenic
981121473 4:141056363-141056385 CTATTTTTAAAAATAGAGATGGG - Intronic
981167273 4:141575997-141576019 CTGATTTTAAAGCTTGAAATCGG - Intergenic
981176236 4:141687205-141687227 CTGCTTACAAGGATGAAGATGGG - Intronic
981184469 4:141784526-141784548 CTGGCTTTGAAGATGGAGAGAGG + Intergenic
981865255 4:149409739-149409761 CTGCTTTTAGAGAGGGAGTGTGG - Intergenic
981885055 4:149664837-149664859 CTGGTTTTCAAGCTGGACATAGG + Intergenic
982293095 4:153799153-153799175 CTGCTGTTAAGGATGGGGCTGGG + Intergenic
982731775 4:158963855-158963877 CTGGCTTTAAAGATGTAGAGGGG + Intronic
982752645 4:159180475-159180497 CTGCTATTATAGATGCAGTTAGG - Intronic
982774948 4:159431659-159431681 CTTCTTTTAAACATAGAGGTGGG + Intergenic
983032327 4:162818501-162818523 TTGCTTCCAAATATGGAGATTGG - Intergenic
983329269 4:166303519-166303541 CTGCTTGAAAAGATGCAGAATGG + Intergenic
984269573 4:177534937-177534959 CTGTTTATAAAGATGCAGCTAGG - Intergenic
984947150 4:184978557-184978579 CTACTTTTCAAATTGGAGATGGG - Intergenic
985760759 5:1747369-1747391 CTGCTTCTAAAGTTGGATGTGGG + Intergenic
986232885 5:5883308-5883330 CTTCTTTTTCAGATGGAGCTTGG - Intergenic
986257587 5:6113406-6113428 CTGCTGTTACAGATTGGGATTGG + Intergenic
987133377 5:14879692-14879714 TTATTTTTAAAGATAGAGATAGG - Intergenic
987306112 5:16639371-16639393 CATCTTTTAAAGATGAAAATTGG - Intergenic
988206729 5:28146301-28146323 CTATTTTTAAAGATATAGATAGG + Intergenic
988371680 5:30377372-30377394 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
988561837 5:32288689-32288711 CTGCTTTTAATGTTGCAGCTCGG + Intronic
988957789 5:36336324-36336346 CTGCTTTTAAAATAGGAGTTTGG - Intergenic
989045597 5:37270423-37270445 CTGCTTTTAATGTTGCAGCTTGG - Intergenic
989344296 5:40411865-40411887 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
990592591 5:57281509-57281531 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
990889747 5:60634873-60634895 GAGCTTTTAAAGATGCAGATGGG - Intronic
991024465 5:62014836-62014858 CCACTTTTAAAGACAGAGATAGG - Intergenic
991033259 5:62103713-62103735 CTGCTTTTAATGTTGCAGCTTGG + Intergenic
991638517 5:68730741-68730763 TTGCCTTTAAAAATGCAGATAGG + Intergenic
992311805 5:75509532-75509554 ATGCATTTAAATATCGAGATTGG + Intronic
992370438 5:76138168-76138190 GTCATTTTAAAGATGAAGATAGG + Intronic
992923628 5:81556272-81556294 CTGCTTTTGAAGATTCACATTGG - Intronic
993411174 5:87575003-87575025 CTGGTTTTGAAGATGGAGGAAGG + Intergenic
993849853 5:92993771-92993793 CTATTTTTAAAGACGGATATAGG - Intergenic
993878358 5:93335709-93335731 CTGGCTTTGAAGATGGAGAAGGG - Intergenic
997497367 5:134340841-134340863 CTGGTTTTAAAAAATGAGATGGG - Intronic
997885206 5:137623900-137623922 CTTCTTCTACAGATGGATATTGG - Intronic
998955820 5:147437153-147437175 CTGCTTCTTAAGAGGGAGCTGGG - Intronic
999005582 5:147973776-147973798 CTGCCTTTGAAGCTGGAGAAAGG - Intergenic
999726721 5:154444740-154444762 CTGCTTCTAAACATGGAAACTGG + Intergenic
1001292991 5:170478080-170478102 CTGCACTGAAAGATGGAGGTAGG - Intronic
1001770756 5:174294161-174294183 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1001899416 5:175412862-175412884 CTGGCTTTGAAGATGGAGAAAGG - Intergenic
1003010769 6:2425347-2425369 CTGATTTTAAAAATGGACAAAGG - Intergenic
1003560903 6:7179293-7179315 TTGCTTTTAAAATTTGAGATGGG + Intronic
1004780752 6:18905860-18905882 CTATTTATAAAGATGGAGGTAGG - Intergenic
1005093495 6:22084292-22084314 CTTCTTTTTAAGAATGAGATTGG + Intergenic
1006062059 6:31430969-31430991 CTGCTTTTAATGTTGCAGCTCGG + Intergenic
1007320033 6:41021455-41021477 GTGCTTTTAGAGAAGGGGATGGG + Intergenic
1008322040 6:50126613-50126635 GTGCTTATAAATATGGACATTGG - Intergenic
1008957913 6:57235859-57235881 CTGGCTTTCAAGATGGAGAAGGG + Intergenic
1009572424 6:65404162-65404184 CTGGTTTTAAAGATGGAGGAAGG - Intronic
1009770599 6:68139039-68139061 CTGCATTTAAAGTTGCAGTTTGG - Intergenic
1010359277 6:74973933-74973955 ATGCTCTTAAAGATAGAGAATGG - Intergenic
1010528037 6:76927164-76927186 CTGCTTTAAAAGTTAGAGGTAGG + Intergenic
1011927764 6:92669169-92669191 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1012471292 6:99575527-99575549 TTGCTTTAAAAGATGGTGAAAGG + Intergenic
1012542250 6:100374823-100374845 CTGCTTTAAAGGATTGATATGGG - Intergenic
1013420295 6:109960981-109961003 CTGGTCTTGAAGATGGAGAGAGG + Intergenic
1013523601 6:110954769-110954791 CTCTCTTTAAAGATAGAGATGGG + Intergenic
1013738753 6:113259099-113259121 CTTCTCTTTAAGATGGAGTTAGG + Intergenic
1014168079 6:118248552-118248574 CTGGCTTTGAAGATGGAGAAAGG + Intronic
1014254987 6:119151943-119151965 ATGCTTTTAAAGTTTGAGGTAGG + Intergenic
1014426587 6:121314174-121314196 CTGTTTTTGAAGATGGAAGTAGG - Intronic
1015868093 6:137748073-137748095 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1015896354 6:138020678-138020700 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1016689412 6:146919272-146919294 CTGCTTTAAAAGATGAAGCCAGG + Intergenic
1018209772 6:161469625-161469647 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1018955372 6:168406522-168406544 CTGCATTTAATGCTGGAGTTTGG - Intergenic
1020079214 7:5277701-5277723 CTTTTTTTAAAAATAGAGATGGG - Intronic
1020218840 7:6218329-6218351 CTGGGTTTGAAGATGGAGAGAGG + Intronic
1020613678 7:10432160-10432182 CTGGTTTTAAAGATAGAAAAAGG - Intergenic
1020744467 7:12064574-12064596 CTCGTTTTAAAGATGCAGAAAGG + Intergenic
1020772556 7:12413392-12413414 CTGGTTTTAAAGATGAAGGAAGG - Intergenic
1021149681 7:17134414-17134436 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1021619330 7:22536103-22536125 CAGCTTTTAAAGAAGGAGCATGG - Intronic
1022636814 7:32144006-32144028 CTGAATTGAGAGATGGAGATGGG + Intronic
1022868062 7:34443519-34443541 CTGTTTTTAAAGTTGCAAATGGG + Intergenic
1022885773 7:34642195-34642217 GTGATTTTCATGATGGAGATGGG + Intergenic
1024182379 7:46909062-46909084 AGGCTTTTAAAGCTGGAAATTGG - Intergenic
1024909842 7:54434599-54434621 CTGATTTAAGAAATGGAGATTGG + Intergenic
1025199681 7:56954484-56954506 CTTTTTTTAAAAATAGAGATGGG + Intergenic
1025761880 7:64403306-64403328 CTGCTTTTAATGTTGCAGCTTGG + Intergenic
1025946715 7:66110327-66110349 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1026185602 7:68080541-68080563 TTTTTTTTAAAGATGGAGTTTGG - Intergenic
1027724053 7:81780867-81780889 CTGATTTTGAAGATGGAGAAAGG + Intergenic
1028371930 7:90101487-90101509 CAGCTTTTAAAGAAGGAGCATGG + Intergenic
1028732182 7:94164092-94164114 CTTATTTTTATGATGGAGATTGG - Intergenic
1028936304 7:96468161-96468183 CTGCTTTTAAAGCTTCATATAGG - Intergenic
1029862284 7:103585696-103585718 CTGGTTTTATAGATTGAGTTAGG - Intronic
1029991838 7:104969462-104969484 CTGGTTTGAAAAATGGAAATGGG + Intergenic
1030062745 7:105636071-105636093 ATGCTTTTCAAGATTGAGATAGG - Intronic
1030265184 7:107613880-107613902 TTGATTTGAAAGATGGAAATGGG + Intronic
1030608933 7:111668134-111668156 CAGATTTTGAAGATGGAGAAAGG + Intergenic
1030799608 7:113833633-113833655 CAGCTTTTTTATATGGAGATTGG - Intergenic
1031127859 7:117794402-117794424 CTGATTATAAAGATGTGGATAGG + Intronic
1031351068 7:120731615-120731637 TTGGTTTTAAAAATGGAGATTGG - Intronic
1031915440 7:127558756-127558778 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1032161685 7:129515851-129515873 CTGCTTTTAAAGATTCAAAGAGG + Intergenic
1032603061 7:133320395-133320417 CTGGTTTTGAAGATGGAGGAAGG - Intronic
1032747104 7:134796884-134796906 TTGCTTTTAAAGATGAGGATGGG - Intronic
1033283130 7:140019695-140019717 CTGCCTTTTAAGCTGGACATAGG + Intronic
1033685460 7:143636260-143636282 CTCACTTTAAAGATGGAGTTTGG - Intronic
1033688630 7:143715478-143715500 CTCACTTTAAAGATGGAGTTTGG - Intronic
1033699154 7:143821360-143821382 CTCACTTTAAAGATGGAGTTTGG + Intergenic
1037089255 8:14893229-14893251 CTCATTTTAAAGATGGAGGAAGG + Intronic
1038030855 8:23638024-23638046 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1038127024 8:24685894-24685916 CTGGCTTTAAAGATGGAGGGAGG - Intergenic
1038410551 8:27355374-27355396 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1038560292 8:28571240-28571262 TTCCTTTTAAAAATGGAGAATGG - Exonic
1039741202 8:40384522-40384544 CTGATTTTGAAGATGGTGAATGG + Intergenic
1040562167 8:48532800-48532822 CGGCTTCTAAATATGGAGAGGGG + Intergenic
1040817960 8:51528744-51528766 CTGGTTTTGAAGCTGGAAATGGG + Intronic
1040916429 8:52570029-52570051 CTGCTTTTAATGTTGCAGCTTGG - Intergenic
1041957362 8:63570745-63570767 CTGACTTTGAAGATGGAGAAGGG + Intergenic
1042693050 8:71525088-71525110 CTCATTTTAGAGATGAAGATGGG + Intronic
1042708713 8:71691050-71691072 CTGACTTTGAAGATGGAGAAAGG - Intergenic
1043019098 8:74978760-74978782 TTTCTTTTAAAGAAGGAGAGAGG - Intergenic
1043927971 8:86059515-86059537 GTGCTTTTGAAGATGGAGAGAGG - Intronic
1044086391 8:87947075-87947097 CTGCTTTAAAAGAGAGAGCTCGG + Intergenic
1044729073 8:95215798-95215820 CTGCTTTTGGTGTTGGAGATGGG + Intergenic
1045221484 8:100204484-100204506 CTGCTTTTAATGTTGCAGCTTGG + Intronic
1045530528 8:102981052-102981074 CTGCTTATAAAGATGTACCTAGG + Intergenic
1045537032 8:103040155-103040177 ATGCTTTAAAAGTTTGAGATAGG + Intronic
1046124298 8:109884885-109884907 CTGGTGTTAAAGATGGAGGAAGG - Intergenic
1046597693 8:116280591-116280613 CTGCTTGCAGAGATGCAGATAGG - Intergenic
1048682714 8:136863412-136863434 CCACTTTTAAAAATTGAGATAGG - Intergenic
1049492396 8:142912327-142912349 CTGCTTCTAAACATTGAAATGGG - Intronic
1049582491 8:143418952-143418974 CTGCATTTGAAGATGAAGAAAGG - Intergenic
1049941180 9:547502-547524 CTTAATTTAAAGATGGTGATGGG + Intronic
1050127893 9:2378442-2378464 CTGGCTTTAAAGATGGAGAAAGG + Intergenic
1050352318 9:4752134-4752156 GGGCTTCTAAAGATGGAGAAGGG + Intergenic
1050447335 9:5739323-5739345 CTGCATTTAAAGCTGCAGCTCGG - Intronic
1050452061 9:5792384-5792406 CTAGTTTTAAAGATGGAAAAGGG + Intronic
1051747302 9:20307246-20307268 CTGCTTTTAAAAAAGGGGATTGG + Intergenic
1051851328 9:21512331-21512353 CCGCTTTTGAAGATGTAGTTAGG + Intergenic
1052229192 9:26126810-26126832 ATGTTTTTAAACATTGAGATTGG - Intergenic
1053721663 9:40952409-40952431 ATTCTTTTGAAGATAGAGATAGG + Intergenic
1053854517 9:42324400-42324422 CTGCGTTTAAATATGAAGACAGG - Intergenic
1054999769 9:71435938-71435960 CTGCCTTTGAAAATGGAGAAAGG + Intronic
1055518182 9:77054254-77054276 CTGACTCTAAAGAGGGAGATTGG - Intergenic
1056741845 9:89263300-89263322 TTGTTTTTAAAAATAGAGATGGG - Intergenic
1057075995 9:92138395-92138417 CTGCTTCTGGAGATGGACATAGG - Intergenic
1057085643 9:92207388-92207410 CTGCTTCTAGAGCTGGAGCTGGG - Intergenic
1057620408 9:96629654-96629676 CTGCATTTAAAAATGGAAAGAGG - Intergenic
1058108415 9:101002488-101002510 CTGGTTTTGAAGATGGAAGTGGG + Intergenic
1058286389 9:103185010-103185032 ATGGTTTTGAAGATGGAGAAAGG + Intergenic
1058581967 9:106468036-106468058 CTGCTTTTCAAGGAGCAGATGGG + Intergenic
1058650101 9:107167618-107167640 TTGCTTTTCAAGATGTAGCTTGG + Intergenic
1058663278 9:107284726-107284748 CTACTTTTAAAAATAGAGTTGGG - Intronic
1058952557 9:109917156-109917178 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1059607536 9:115850541-115850563 CTGCTTTTAAAGAAGGGAAGAGG - Intergenic
1059949866 9:119451090-119451112 CTGGTTTTAAAGGTGGAGGAAGG - Intergenic
1060318825 9:122536293-122536315 CTGTTTTTAAAGGTGGATATTGG - Intergenic
1061648267 9:132024315-132024337 CTCCTTTTACAGATGAAGAATGG + Intronic
1186125040 X:6404261-6404283 CTGGCTTTGAAGATGGAAATTGG + Intergenic
1186215529 X:7296330-7296352 CTTCTTGCAAAGATAGAGATTGG - Intronic
1186379228 X:9039645-9039667 CTGGCTTTAACGATGGAAATTGG - Intronic
1186437649 X:9556871-9556893 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1186470072 X:9814276-9814298 CTGCTTTTAATGTTGCAGCTGGG - Intronic
1186880152 X:13857008-13857030 CTGACTTTGAAGATGGAGAAAGG - Intronic
1189730139 X:44011613-44011635 CTGGCTTTGAAGATGGAGAAAGG - Intergenic
1190528591 X:51352553-51352575 CTGGCTTTGAAGATGGAGTTAGG - Intergenic
1193238326 X:79136098-79136120 CAGATTTTAAAGTTGGAGACTGG + Intergenic
1193828340 X:86255245-86255267 CTCCTGTTTAAAATGGAGATTGG - Intronic
1194129230 X:90059611-90059633 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1194520520 X:94913355-94913377 CTGCGTTTAAACATGAATATTGG + Intergenic
1194960878 X:100234286-100234308 CTGACTTTGAAGATGGAGAAAGG + Intergenic
1194992771 X:100562882-100562904 GTACTTTTAAAGATACAGATTGG - Intergenic
1195008250 X:100708549-100708571 CTGGTTTTCAAGAAGGGGATGGG + Intronic
1196745616 X:119069586-119069608 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1197337793 X:125229361-125229383 GTGCTTTAAAATATTGAGATAGG + Intergenic
1197816290 X:130502112-130502134 CAGATTTTAAAGGTGGAGATAGG - Intergenic
1198252088 X:134889768-134889790 CTGCTTTAAAAGATGGACAGGGG + Intronic
1198783320 X:140259995-140260017 CTGCTTTTAATGTTGCAGCTCGG - Intergenic
1199627363 X:149752788-149752810 CTGCTTTTAATGTTGCAGCTTGG - Intergenic
1201606762 Y:15794397-15794419 CTGGCTTTGAAGATGGAAATTGG + Intergenic
1201610415 Y:15836919-15836941 CACCTGTTAAGGATGGAGATTGG + Intergenic
1201953257 Y:19588862-19588884 CTACTGGTAACGATGGAGATAGG - Intergenic