ID: 1142189818

View in Genome Browser
Species Human (GRCh38)
Location 16:88712661-88712683
Sequence CAGGAGCTGGTGGGATCCGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 193}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142189803_1142189818 30 Left 1142189803 16:88712608-88712630 CCTCATCCCGGAAGGTGTTCAGC 0: 1
1: 0
2: 1
3: 5
4: 94
Right 1142189818 16:88712661-88712683 CAGGAGCTGGTGGGATCCGAGGG 0: 1
1: 0
2: 1
3: 18
4: 193
1142189809_1142189818 4 Left 1142189809 16:88712634-88712656 CCACCGTCGGTGCTTTGGTGCTC 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1142189818 16:88712661-88712683 CAGGAGCTGGTGGGATCCGAGGG 0: 1
1: 0
2: 1
3: 18
4: 193
1142189810_1142189818 1 Left 1142189810 16:88712637-88712659 CCGTCGGTGCTTTGGTGCTCTGC 0: 1
1: 0
2: 0
3: 4
4: 103
Right 1142189818 16:88712661-88712683 CAGGAGCTGGTGGGATCCGAGGG 0: 1
1: 0
2: 1
3: 18
4: 193
1142189805_1142189818 23 Left 1142189805 16:88712615-88712637 CCGGAAGGTGTTCAGCCTGCCAC 0: 1
1: 0
2: 0
3: 30
4: 171
Right 1142189818 16:88712661-88712683 CAGGAGCTGGTGGGATCCGAGGG 0: 1
1: 0
2: 1
3: 18
4: 193
1142189808_1142189818 8 Left 1142189808 16:88712630-88712652 CCTGCCACCGTCGGTGCTTTGGT 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1142189818 16:88712661-88712683 CAGGAGCTGGTGGGATCCGAGGG 0: 1
1: 0
2: 1
3: 18
4: 193
1142189804_1142189818 24 Left 1142189804 16:88712614-88712636 CCCGGAAGGTGTTCAGCCTGCCA 0: 1
1: 0
2: 1
3: 11
4: 148
Right 1142189818 16:88712661-88712683 CAGGAGCTGGTGGGATCCGAGGG 0: 1
1: 0
2: 1
3: 18
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142189818 Original CRISPR CAGGAGCTGGTGGGATCCGA GGG Exonic
900121799 1:1051457-1051479 CAGCAGCTGGCGGCCTCCGAGGG - Exonic
900574666 1:3377179-3377201 CAGGAGCTGGCGGGAGCCGGGGG - Intronic
900971065 1:5992693-5992715 CAGGAGCTAGCGGGATTCGGGGG + Intronic
901157690 1:7151443-7151465 CAGGAGCTGGTGGGGTCACCAGG - Intronic
901327499 1:8376862-8376884 CAGGTGTTGGAGGGATCCCAGGG + Intronic
903820692 1:26100295-26100317 CAAGAGCTGGGGGGAAACGATGG - Intergenic
904481815 1:30798677-30798699 CAGGTGCTGGTGGGTTGTGAGGG - Intergenic
905835499 1:41116890-41116912 CTGGAGCTGGTGATATCTGAGGG + Intronic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
906962465 1:50426797-50426819 CAGGAACTGGTGGCGTCCAAAGG + Intergenic
907136165 1:52141860-52141882 CAGGGGTTGGTGGGAACTGAGGG + Intergenic
907415789 1:54312936-54312958 CAGGAGGGGGTGGGATGGGAAGG + Intronic
908380689 1:63594174-63594196 GAGGAGCGGGCGGGATGCGAGGG - Intronic
911537627 1:99119430-99119452 CAGGAGCTGCTGTTATCCAAAGG - Intergenic
912681133 1:111729724-111729746 CAGAAGGTGGAGGGATCCGAAGG + Intronic
913040567 1:115018832-115018854 CAGGAGCTGATGCGATCCACGGG - Intergenic
913426598 1:118738181-118738203 CAGCATCTGATGGGATCCTAAGG - Intergenic
914205000 1:145519068-145519090 CAGGAGCTGATGGGGTGGGAGGG - Intergenic
914484119 1:148092250-148092272 CAGGAGCTGATGGGGTGGGAGGG - Intergenic
914814611 1:151054287-151054309 CAGGAGCAGATGAGATCCAAGGG - Exonic
918219767 1:182426301-182426323 CAAGAGCTGATGGGATCCAGTGG + Intergenic
919786347 1:201260794-201260816 CAGGTGCTGGTGGGATGCGAAGG - Intergenic
920192623 1:204203128-204203150 CAGGGGATGGTGGGATGGGAAGG + Intronic
922558411 1:226549775-226549797 CAGGAACAGAAGGGATCCGAGGG - Intronic
1063556427 10:7084055-7084077 CTGGAGCTGGTGGGAACAGAAGG + Intergenic
1064924694 10:20556772-20556794 CAGGAGCTGATGGGATCAACAGG + Intergenic
1066250244 10:33626138-33626160 GAGGAGGTGGTGGGATCAGAAGG + Intergenic
1069775707 10:70925986-70926008 CAGGAGCTGGTGGGATGGTAAGG - Intergenic
1072874189 10:99153965-99153987 CAGGAGCTGATGCGATCAAATGG + Intronic
1073105058 10:101027968-101027990 AAGGAGCTGGTGGGATCTCATGG + Intronic
1073918886 10:108436268-108436290 CAGGAGCTGGTAAGAACTGAAGG - Intergenic
1074673360 10:115820897-115820919 CAGGACCTGGTGGGAGGTGATGG + Intronic
1075406352 10:122198358-122198380 CCGGAGCTGGAAGGATCTGAAGG - Intronic
1076158621 10:128223418-128223440 TAGGAGCTTGTGGGTTCCCAGGG + Intergenic
1076697340 10:132253329-132253351 AGGGAGCTGGAGGGAGCCGAGGG + Intronic
1076697407 10:132253576-132253598 AGGGAGCTGGAGGGAGCCGAGGG + Intronic
1076697413 10:132253595-132253617 AGGGAGCTGGAGGGAGCCGAGGG + Intronic
1076698956 10:132260411-132260433 CAGGAGCTGGTGGAGGCAGAGGG - Intronic
1076993343 11:287122-287144 CAGGGGCTGGTGGGAATGGATGG + Intergenic
1077235476 11:1480152-1480174 CAGGAGCTGGTGGGGGTTGATGG - Intronic
1077454441 11:2670001-2670023 CAGGAGCTGTTGGGGTCCCGTGG + Intronic
1080583287 11:33660597-33660619 CAGAGGCAGGTGGGATGCGATGG - Intronic
1083680778 11:64351005-64351027 CAGGGACTTGTGGGATCCAAGGG + Intronic
1083769762 11:64860050-64860072 GAGGAGCGGGTGGGACCAGAAGG + Exonic
1084008166 11:66334052-66334074 CAGGCTCAGGTGGGACCCGAAGG + Exonic
1084729412 11:71063975-71063997 CAGCAGCTGGTGGGAACTGCAGG - Intronic
1088779662 11:113122131-113122153 CAGGAGGGGATGGGATCTGAAGG - Intronic
1089294565 11:117459875-117459897 CAGCAGCTGCTGGGATCCAGAGG + Intronic
1089508393 11:118979992-118980014 CAGAAGCAGGTGGGAACCGTTGG - Intronic
1091358407 11:134955886-134955908 CAGTAGCTGGTTGTATCTGAAGG - Intergenic
1091759246 12:3076769-3076791 CAGGAGCTGGCGGCCTCCAAGGG - Intergenic
1092218395 12:6697683-6697705 CTGGGGCTGGTGGGGTTCGAGGG + Exonic
1094494187 12:30979262-30979284 CAGAAGCTGGTGGGAGGCGGTGG - Intronic
1097152056 12:56986440-56986462 CAGGAGCTGGTGGGAGGTGTTGG + Intergenic
1097264105 12:57736179-57736201 CCGGAGCGGGTGGGAGCAGATGG - Intronic
1097304901 12:58058448-58058470 CAGGAGCTGGTGTGATCAACTGG - Intergenic
1103083184 12:118041609-118041631 CAGGGGCTGGAGGGATTGGAAGG - Intronic
1103083197 12:118041661-118041683 CAGGGGCTGGAGGGATTGGAAGG - Intronic
1103640589 12:122348463-122348485 AAAGAGCTGGTGGGTTCCTAAGG + Intronic
1104607126 12:130198351-130198373 CAGGAGCTGCTGGGATGCCGTGG + Intergenic
1104845117 12:131842913-131842935 CAGGGGCTGGGGGGATGGGATGG - Intronic
1105449027 13:20482338-20482360 CAGTAGCTGGTGGGAGCCATGGG - Intronic
1107690964 13:42952581-42952603 GAGGAGCTGGTGGGAAGCTAAGG - Intronic
1112185495 13:97124389-97124411 CAGGAGTTGGTGGGGACAGAAGG - Intergenic
1112365637 13:98752810-98752832 CAGGTGCGGGTGGGCCCCGACGG + Intergenic
1113587764 13:111476905-111476927 CAGGACCTGGTGGGAGGTGATGG + Intergenic
1120738677 14:88083457-88083479 CAGGAGCTGGCGTCATCAGAAGG - Intergenic
1121338966 14:93093818-93093840 CAGGGGCTTGTGGGATTGGAGGG - Intronic
1122645291 14:103189657-103189679 GGGGAGCGGGTGGGGTCCGACGG - Intergenic
1123115421 14:105892193-105892215 CAGGAGGGGATGGGATCCGGGGG + Intergenic
1124344100 15:28909922-28909944 CAGTAGCTGGTGCGATCCTCTGG + Intronic
1127330181 15:57931448-57931470 AAGGAACTGGTGTGATCCTATGG - Intergenic
1127742181 15:61921100-61921122 CAGAAGCTGATGGAATCTGATGG - Intronic
1127849658 15:62901656-62901678 CAGCATGAGGTGGGATCCGAAGG + Intergenic
1128716611 15:69913385-69913407 TGGGAGCTGGTGGGAGCCGAGGG - Intergenic
1129388487 15:75208610-75208632 CAGAAGCGGGTGGCAGCCGAGGG - Exonic
1129790064 15:78335199-78335221 TAGGAGGTGGTGGGGTCTGAAGG - Intergenic
1129940263 15:79490566-79490588 CAGGAGCTGGTGCGATCAACTGG - Intergenic
1131130887 15:89899571-89899593 CAGGACCTGGGGGGAGACGAAGG - Exonic
1132007570 15:98243108-98243130 CAGGGGCGGGTGGGGTCAGAGGG + Intergenic
1132112080 15:99109025-99109047 CAGGAGCTGGAGGCAGCAGAGGG + Intronic
1134655648 16:15946662-15946684 CCGGAGCAGGTGGGGTCAGAAGG - Intergenic
1134823934 16:17269516-17269538 CAGGAGCTGGGGTCATCCCAGGG - Intronic
1135330160 16:21554118-21554140 CAGGAGCTGCTGGGACCAGAAGG + Intergenic
1135587321 16:23680795-23680817 CAGAGGCTTGTGGGATCAGATGG + Intronic
1136382429 16:29901708-29901730 CAGGAGCTGGTAGCACCCGGGGG - Exonic
1137594388 16:49714161-49714183 CAGGAGATCATGGGCTCCGAAGG + Intronic
1138087062 16:54142818-54142840 CAGGAGCTGGTGGGGACAGCAGG + Intergenic
1138527901 16:57619627-57619649 CAGCAGCTGGTGGGGTCAGGAGG - Intronic
1141470121 16:84232413-84232435 CAGGGGCTGGTGGGAGAGGAAGG + Intronic
1142043200 16:87908634-87908656 CGGGAGCTGCTGGGACCGGAAGG + Intronic
1142154863 16:88528298-88528320 CAGGAGAGGGTGGGAGCTGAGGG + Intronic
1142189818 16:88712661-88712683 CAGGAGCTGGTGGGATCCGAGGG + Exonic
1142305331 16:89281275-89281297 CAGGCGCTGGTGGGAGCGGTGGG + Exonic
1142597843 17:1038231-1038253 TAGGAGCTGCTGGGAACCTAAGG - Intronic
1142681366 17:1550970-1550992 CAGGACCTGATGGGACACGAAGG + Intronic
1142941791 17:3386065-3386087 GTGGCGCTGGTGAGATCCGACGG + Intergenic
1147150057 17:38509372-38509394 GGGGAGCTGGTGGGGTCCGGCGG + Intronic
1148085572 17:44991856-44991878 CTGGAGCTGCTGGGATGAGATGG - Intergenic
1148528082 17:48361887-48361909 CAGAAGCTGGTGGGATGGGTAGG - Intronic
1149631666 17:58130547-58130569 GGGGAGCTGGTGGGAGCTGAGGG - Intergenic
1150346361 17:64407430-64407452 CAGGAGCTGGCGGGGTGCGGTGG + Intronic
1151361586 17:73592527-73592549 CAGGAGGTGGTGGGGACAGATGG - Intronic
1151430549 17:74059669-74059691 CAGCAGCTGGTGGGTTGCCATGG + Intergenic
1151550794 17:74821481-74821503 TTGGAGCTGGTGGGATCCCCAGG - Intronic
1152546624 17:81003621-81003643 CAGGGGCTGGTGGGGTTCGGGGG - Intronic
1155168854 18:23252202-23252224 CAGGAGCTGGAGGGAGTGGATGG + Intronic
1159959051 18:74541421-74541443 CAGGAGCTGATGGTATCTGGAGG + Intronic
1160662870 19:309155-309177 CAGGAGCTGGAGGGCTCTGAGGG - Intronic
1160861330 19:1238241-1238263 CAGGAGGGGGTGGGGTCCGGGGG + Intergenic
1161522008 19:4729969-4729991 CCGGAGCAGGAGGGATCCGGCGG - Intergenic
1161683834 19:5693520-5693542 CGGGAGCAGGTGGGAGCGGATGG + Intronic
1162078442 19:8204732-8204754 CAGGAGCAGCTGGGATCACAGGG - Intronic
1162909608 19:13842135-13842157 CAGGGGCTGGTGGGAGCTGGGGG - Intergenic
1162937499 19:13988563-13988585 CAGGAGCTGATGGGACATGATGG + Intronic
1163397352 19:17071459-17071481 CAGGACCAGGTGGGGTCCCAGGG + Intronic
1163875336 19:19863070-19863092 TAGGAGCTGGTTGCATCCTATGG - Intergenic
1164011921 19:21211017-21211039 TTGGAGATGGTGGGATCCAATGG - Intergenic
1164305344 19:24001081-24001103 GAGAAGCTGGTGGGAGCCCAGGG - Intergenic
1164333524 19:24284552-24284574 CAGGAGCTGATGGGATCAACTGG - Intergenic
1164428497 19:28166360-28166382 CAGGTGCAGGTGGGATGCAAAGG + Intergenic
1165471350 19:36006588-36006610 CAGGACCTGGTGGGGTCTGGGGG - Exonic
1166858170 19:45793531-45793553 TAGGAGCTGTTGGGATCAGGGGG - Intergenic
1167072064 19:47227355-47227377 CAGGACCTGGTGGGACGGGAGGG - Intronic
936286337 2:111184256-111184278 CCGGGCCTGGTGGGATCAGAAGG - Intergenic
937400535 2:121579234-121579256 GAGGGGCTGGGGGGATCTGAAGG + Intronic
946330316 2:219005379-219005401 AATGAGCTGGAGGGATGCGAAGG + Intronic
948125398 2:235561316-235561338 CAGGAGCTGCTGGGGTCTGCGGG + Intronic
948284089 2:236770520-236770542 CAGGACTTAGAGGGATCCGAGGG + Intergenic
948353320 2:237358527-237358549 GAGGAGATGTTGGGATTCGAGGG - Exonic
948599055 2:239097654-239097676 CAGGAGCTGGCGGGATGTGGTGG + Intronic
948772315 2:240258005-240258027 CAGGAGCGGGAAGGAGCCGAGGG + Intergenic
1172655238 20:36532787-36532809 CAGAAGATGGTGGGCTCCCAAGG + Intergenic
1172699891 20:36846584-36846606 CAGAAGCTGGTGAGAACCGGTGG - Intronic
1174184889 20:48699467-48699489 TAGTAGCTGGTGGGAACTGATGG - Intronic
1178279162 21:31266144-31266166 CAGCAGCTGGTGGCATCTTATGG + Exonic
1180048555 21:45320941-45320963 CGGCAGCAGCTGGGATCCGAGGG + Intergenic
1181022806 22:20112519-20112541 CAGGAGCTGAAGGGCTCCCAGGG - Exonic
1181976696 22:26735997-26736019 CAGGATATGGTGGGATGGGATGG - Intergenic
1184220228 22:43095147-43095169 CCAGAGCTGGTGGGAGACGAGGG + Intergenic
1184371301 22:44083788-44083810 CTGGAGCTGGTGGGAGCCATGGG + Intronic
1184536572 22:45091665-45091687 CCGGAGCTGGAGGGATCCGCAGG - Intergenic
1185228150 22:49664872-49664894 CAGGACAGAGTGGGATCCGAGGG - Intergenic
949850372 3:8414341-8414363 CATCAGCTGGTGGGTTCCAATGG - Intergenic
953222619 3:40986520-40986542 GAGGTGCTGCTGGGATCCCAAGG - Intergenic
955246306 3:57227946-57227968 CGGGAGCTGGTGGGCGACGAGGG + Intronic
959554026 3:107696976-107696998 CAGGAGCTGATGCGATCAAATGG - Intronic
960238848 3:115317097-115317119 CAGGAGCTGATGCGATCCACTGG - Intergenic
962103498 3:132366942-132366964 AAAGAGCTGATGGGATCAGAGGG + Intronic
963610440 3:147460301-147460323 AAGGAGATGGTGGGATCCTAGGG + Intronic
966835439 3:184046069-184046091 CTGCAGCAGGTGGGATCCGGAGG - Intergenic
967851402 3:194085344-194085366 CAGGATCATGTGGGATCCTAGGG - Intergenic
968003196 3:195221708-195221730 CTGGAGCTGGAGGGAGCCAAGGG - Intronic
968405543 4:336874-336896 CAGGAGCTCCTGGGAACCGAGGG + Intergenic
969518350 4:7661337-7661359 CAGGAGCAGGTGGGGTCCTGGGG + Intronic
971294485 4:25376936-25376958 CAGGTGCTGGTGGGATCGCTGGG - Intergenic
974377954 4:61102155-61102177 CAGGAACTGGTGGAATCTGTTGG - Intergenic
978197698 4:105990363-105990385 CATGAGCTGGTGGGAATCCAGGG - Intronic
979085692 4:116406931-116406953 CAGGAGCTGATGTGATCAAATGG + Intergenic
984710111 4:182877816-182877838 AAGGAGCTGGTGGGATGAGGGGG - Intergenic
985758002 5:1730610-1730632 CAGGACCCTGTGCGATCCGATGG + Intergenic
992582629 5:78196854-78196876 CAGGAGCTGGTGGGGAGGGAGGG + Intronic
993354322 5:86887107-86887129 CAGGGGCTGGTGGAGTCAGATGG + Intergenic
994742079 5:103632465-103632487 CAGCAGATGGTAGGATCAGAAGG - Intergenic
996593925 5:125179767-125179789 CAGCAGATGGTGAGATCTGAAGG + Intergenic
997437461 5:133885542-133885564 GAGGAGCTGGGGGGAGGCGAGGG + Intergenic
1000230879 5:159314076-159314098 GAGGAGATGGTGGGATCAGAGGG - Intergenic
1005889719 6:30127248-30127270 CAGGATGGGGAGGGATCCGAAGG + Intergenic
1006388049 6:33742962-33742984 AAGGAGATGGTGGGAGGCGATGG + Intronic
1007642925 6:43357283-43357305 CAGGAGCTGGTTGGAGTTGATGG - Exonic
1011380031 6:86732745-86732767 CAGGAGCTGATGGGATCAACTGG + Intergenic
1011415975 6:87120508-87120530 AAGGAGGTGGTGGGATCCTTGGG - Intergenic
1015696889 6:135990509-135990531 CAAGAGCTGTTGGGAGCAGAGGG - Intronic
1017154587 6:151311727-151311749 CAGGAGCTGGTGGGTTCAAATGG - Intronic
1019278278 7:187471-187493 CAGCAGCTGGTTGGAGCCCAGGG - Intergenic
1019306671 7:338718-338740 CAGCAGCGGGTGGGTTCCGTGGG + Intergenic
1019489540 7:1305749-1305771 CAGGAGAGGGTGGTATCCCAGGG - Intergenic
1019606463 7:1912630-1912652 CTGGAGCTGGTGGGATGAGAGGG - Intronic
1021933331 7:25604247-25604269 CAGGAGCTGATGGGATCAACTGG + Intergenic
1022638502 7:32159897-32159919 CAGGAGCTTGTGGGAGCCTCTGG - Intronic
1031022880 7:116647774-116647796 CAGGAGTTGTTGGGAGCAGATGG + Intergenic
1033235650 7:139635915-139635937 CAGCAGCTGCTGGGAGACGAAGG - Intronic
1034448559 7:151125736-151125758 CAGGAGCTGGGGGGAGGGGAAGG - Intronic
1035425925 7:158773143-158773165 CGGGAGCTGCTGGGAGGCGATGG - Intronic
1038787282 8:30630231-30630253 CAGGAGCTGGTGAGATGAGGTGG + Intronic
1040015518 8:42696136-42696158 CAGGAGCTGGTGGTCTAGGAAGG + Intergenic
1042152106 8:65799085-65799107 CAGGGGCTGGGGGGAACCTATGG + Intronic
1046547212 8:115667955-115667977 CTGGAGGTGGTTGGACCCGAGGG - Intronic
1046676113 8:117110541-117110563 CAGGAGCTGGCTGGATGCCAGGG + Intronic
1047409066 8:124609424-124609446 TAGGAGCAGGTGGGAACCGAGGG - Intronic
1048531902 8:135257288-135257310 CAGGCCCTGGTGGGATCCACTGG - Intergenic
1048865207 8:138755732-138755754 CAGGTGCTGGTGGGATTGGGTGG - Intronic
1053420029 9:37971500-37971522 CAGGAGCTGGAGGGGTCCTATGG - Intronic
1053576051 9:39358021-39358043 CAGGAGCCGGTGGGGCCGGAGGG - Intronic
1053840566 9:42185958-42185980 CAGGAGCCGGTGGGGCCGGAGGG - Intronic
1054097622 9:60916712-60916734 CAGGAGCCGGTGGGGCCGGAGGG - Intergenic
1054119024 9:61192342-61192364 CAGGAGCCGGTGGGGCCGGAGGG - Intronic
1054588728 9:66990220-66990242 CAGGAGCCGGTGGGGCCGGAGGG + Intergenic
1055251089 9:74306528-74306550 CAGGAGCAGATGGTATCCAAGGG - Intergenic
1056388220 9:86116847-86116869 GAGGAGCTGGGGGGAGCAGAGGG + Intergenic
1056612221 9:88132741-88132763 CAGGAGCAGATGGGTTCGGAGGG + Intergenic
1057941469 9:99288932-99288954 CAGGAGCTGGTGGGCTTCGGGGG + Intergenic
1062052938 9:134456860-134456882 CAGGAGCCTGTGGGGTCAGATGG - Intergenic
1062092207 9:134684264-134684286 CAGGAGCTGATGGAATGAGATGG - Intronic
1185666836 X:1772274-1772296 GAGGAGCTGGTGGGAGGTGATGG + Intergenic
1186876775 X:13825366-13825388 CAGGAGTGGGTGGGATGCCAAGG + Intronic
1189237983 X:39503257-39503279 CAGGAACTGGTGGGATGAAAAGG - Intergenic
1192320175 X:70084417-70084439 CAAGAGCAGGTGGGATGTGAGGG + Intergenic
1197749311 X:129953731-129953753 CAGGAGTTGGTAGGATGGGAAGG - Intergenic
1198311817 X:135432513-135432535 CAGAGGCAGGGGGGATCCGAGGG - Intergenic
1199715260 X:150503447-150503469 CTGGGGCAGCTGGGATCCGAAGG + Intronic
1200787895 Y:7274940-7274962 CAGGAGCAGCTGGGCTCCGGGGG + Intergenic
1201698826 Y:16857482-16857504 CAGGAGCTGATGCGATCAAATGG - Intergenic