ID: 1142190456

View in Genome Browser
Species Human (GRCh38)
Location 16:88714939-88714961
Sequence CAAGCCCGGCCCAGGACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 258}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142190456_1142190467 6 Left 1142190456 16:88714939-88714961 CCACCTGTCCTGGGCCGGGCTTG 0: 1
1: 0
2: 0
3: 20
4: 258
Right 1142190467 16:88714968-88714990 CGGGAAGGCCGTCACCTCGTGGG 0: 1
1: 0
2: 0
3: 2
4: 37
1142190456_1142190465 -9 Left 1142190456 16:88714939-88714961 CCACCTGTCCTGGGCCGGGCTTG 0: 1
1: 0
2: 0
3: 20
4: 258
Right 1142190465 16:88714953-88714975 CCGGGCTTGGGGACGCGGGAAGG 0: 1
1: 0
2: 3
3: 17
4: 268
1142190456_1142190466 5 Left 1142190456 16:88714939-88714961 CCACCTGTCCTGGGCCGGGCTTG 0: 1
1: 0
2: 0
3: 20
4: 258
Right 1142190466 16:88714967-88714989 GCGGGAAGGCCGTCACCTCGTGG 0: 1
1: 0
2: 0
3: 3
4: 48
1142190456_1142190470 16 Left 1142190456 16:88714939-88714961 CCACCTGTCCTGGGCCGGGCTTG 0: 1
1: 0
2: 0
3: 20
4: 258
Right 1142190470 16:88714978-88715000 GTCACCTCGTGGGTGGCTTGAGG 0: 1
1: 0
2: 1
3: 7
4: 89
1142190456_1142190468 9 Left 1142190456 16:88714939-88714961 CCACCTGTCCTGGGCCGGGCTTG 0: 1
1: 0
2: 0
3: 20
4: 258
Right 1142190468 16:88714971-88714993 GAAGGCCGTCACCTCGTGGGTGG 0: 1
1: 0
2: 0
3: 2
4: 45
1142190456_1142190473 19 Left 1142190456 16:88714939-88714961 CCACCTGTCCTGGGCCGGGCTTG 0: 1
1: 0
2: 0
3: 20
4: 258
Right 1142190473 16:88714981-88715003 ACCTCGTGGGTGGCTTGAGGGGG 0: 1
1: 0
2: 2
3: 10
4: 99
1142190456_1142190476 29 Left 1142190456 16:88714939-88714961 CCACCTGTCCTGGGCCGGGCTTG 0: 1
1: 0
2: 0
3: 20
4: 258
Right 1142190476 16:88714991-88715013 TGGCTTGAGGGGGTGCTGGCAGG 0: 1
1: 1
2: 2
3: 16
4: 349
1142190456_1142190475 25 Left 1142190456 16:88714939-88714961 CCACCTGTCCTGGGCCGGGCTTG 0: 1
1: 0
2: 0
3: 20
4: 258
Right 1142190475 16:88714987-88715009 TGGGTGGCTTGAGGGGGTGCTGG 0: 1
1: 0
2: 0
3: 43
4: 423
1142190456_1142190471 17 Left 1142190456 16:88714939-88714961 CCACCTGTCCTGGGCCGGGCTTG 0: 1
1: 0
2: 0
3: 20
4: 258
Right 1142190471 16:88714979-88715001 TCACCTCGTGGGTGGCTTGAGGG 0: 1
1: 0
2: 1
3: 5
4: 86
1142190456_1142190472 18 Left 1142190456 16:88714939-88714961 CCACCTGTCCTGGGCCGGGCTTG 0: 1
1: 0
2: 0
3: 20
4: 258
Right 1142190472 16:88714980-88715002 CACCTCGTGGGTGGCTTGAGGGG 0: 1
1: 0
2: 0
3: 8
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142190456 Original CRISPR CAAGCCCGGCCCAGGACAGG TGG (reversed) Intronic