ID: 1142190464

View in Genome Browser
Species Human (GRCh38)
Location 16:88714953-88714975
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 205}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142190464_1142190475 11 Left 1142190464 16:88714953-88714975 CCGGGCTTGGGGACGCGGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1142190475 16:88714987-88715009 TGGGTGGCTTGAGGGGGTGCTGG 0: 1
1: 0
2: 0
3: 43
4: 423
1142190464_1142190477 23 Left 1142190464 16:88714953-88714975 CCGGGCTTGGGGACGCGGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1142190477 16:88714999-88715021 GGGGGTGCTGGCAGGTTTCTTGG 0: 1
1: 0
2: 1
3: 32
4: 292
1142190464_1142190467 -8 Left 1142190464 16:88714953-88714975 CCGGGCTTGGGGACGCGGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1142190467 16:88714968-88714990 CGGGAAGGCCGTCACCTCGTGGG 0: 1
1: 0
2: 0
3: 2
4: 37
1142190464_1142190466 -9 Left 1142190464 16:88714953-88714975 CCGGGCTTGGGGACGCGGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1142190466 16:88714967-88714989 GCGGGAAGGCCGTCACCTCGTGG 0: 1
1: 0
2: 0
3: 3
4: 48
1142190464_1142190473 5 Left 1142190464 16:88714953-88714975 CCGGGCTTGGGGACGCGGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1142190473 16:88714981-88715003 ACCTCGTGGGTGGCTTGAGGGGG 0: 1
1: 0
2: 2
3: 10
4: 99
1142190464_1142190471 3 Left 1142190464 16:88714953-88714975 CCGGGCTTGGGGACGCGGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1142190471 16:88714979-88715001 TCACCTCGTGGGTGGCTTGAGGG 0: 1
1: 0
2: 1
3: 5
4: 86
1142190464_1142190470 2 Left 1142190464 16:88714953-88714975 CCGGGCTTGGGGACGCGGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1142190470 16:88714978-88715000 GTCACCTCGTGGGTGGCTTGAGG 0: 1
1: 0
2: 1
3: 7
4: 89
1142190464_1142190468 -5 Left 1142190464 16:88714953-88714975 CCGGGCTTGGGGACGCGGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1142190468 16:88714971-88714993 GAAGGCCGTCACCTCGTGGGTGG 0: 1
1: 0
2: 0
3: 2
4: 45
1142190464_1142190476 15 Left 1142190464 16:88714953-88714975 CCGGGCTTGGGGACGCGGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1142190476 16:88714991-88715013 TGGCTTGAGGGGGTGCTGGCAGG 0: 1
1: 1
2: 2
3: 16
4: 349
1142190464_1142190472 4 Left 1142190464 16:88714953-88714975 CCGGGCTTGGGGACGCGGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1142190472 16:88714980-88715002 CACCTCGTGGGTGGCTTGAGGGG 0: 1
1: 0
2: 0
3: 8
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142190464 Original CRISPR CCTTCCCGCGTCCCCAAGCC CGG (reversed) Intronic