ID: 1142190469 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:88714976-88714998 |
| Sequence | TCAAGCCACCCACGAGGTGA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 117 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 6, 4: 110} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1142190469_1142190477 | 0 | Left | 1142190469 | 16:88714976-88714998 | CCGTCACCTCGTGGGTGGCTTGA | 0: 1 1: 0 2: 0 3: 6 4: 110 |
||
| Right | 1142190477 | 16:88714999-88715021 | GGGGGTGCTGGCAGGTTTCTTGG | 0: 1 1: 0 2: 1 3: 32 4: 292 |
||||
| 1142190469_1142190478 | 14 | Left | 1142190469 | 16:88714976-88714998 | CCGTCACCTCGTGGGTGGCTTGA | 0: 1 1: 0 2: 0 3: 6 4: 110 |
||
| Right | 1142190478 | 16:88715013-88715035 | GTTTCTTGGCCCCTCGACACCGG | 0: 1 1: 0 2: 0 3: 2 4: 64 |
||||
| 1142190469_1142190476 | -8 | Left | 1142190469 | 16:88714976-88714998 | CCGTCACCTCGTGGGTGGCTTGA | 0: 1 1: 0 2: 0 3: 6 4: 110 |
||
| Right | 1142190476 | 16:88714991-88715013 | TGGCTTGAGGGGGTGCTGGCAGG | 0: 1 1: 1 2: 2 3: 16 4: 349 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1142190469 | Original CRISPR | TCAAGCCACCCACGAGGTGA CGG (reversed) | Intronic | ||