ID: 1142190471

View in Genome Browser
Species Human (GRCh38)
Location 16:88714979-88715001
Sequence TCACCTCGTGGGTGGCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 86}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142190459_1142190471 14 Left 1142190459 16:88714942-88714964 CCTGTCCTGGGCCGGGCTTGGGG 0: 1
1: 0
2: 3
3: 47
4: 439
Right 1142190471 16:88714979-88715001 TCACCTCGTGGGTGGCTTGAGGG 0: 1
1: 0
2: 1
3: 5
4: 86
1142190455_1142190471 18 Left 1142190455 16:88714938-88714960 CCCACCTGTCCTGGGCCGGGCTT 0: 1
1: 0
2: 2
3: 10
4: 155
Right 1142190471 16:88714979-88715001 TCACCTCGTGGGTGGCTTGAGGG 0: 1
1: 0
2: 1
3: 5
4: 86
1142190464_1142190471 3 Left 1142190464 16:88714953-88714975 CCGGGCTTGGGGACGCGGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1142190471 16:88714979-88715001 TCACCTCGTGGGTGGCTTGAGGG 0: 1
1: 0
2: 1
3: 5
4: 86
1142190456_1142190471 17 Left 1142190456 16:88714939-88714961 CCACCTGTCCTGGGCCGGGCTTG 0: 1
1: 0
2: 0
3: 20
4: 258
Right 1142190471 16:88714979-88715001 TCACCTCGTGGGTGGCTTGAGGG 0: 1
1: 0
2: 1
3: 5
4: 86
1142190461_1142190471 9 Left 1142190461 16:88714947-88714969 CCTGGGCCGGGCTTGGGGACGCG 0: 1
1: 0
2: 3
3: 27
4: 278
Right 1142190471 16:88714979-88715001 TCACCTCGTGGGTGGCTTGAGGG 0: 1
1: 0
2: 1
3: 5
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142190471 Original CRISPR TCACCTCGTGGGTGGCTTGA GGG Intronic
909818475 1:80027639-80027661 TCTGCTGGTGGGTGGCTTGCTGG - Intergenic
920248752 1:204608083-204608105 GCACCTCGTGGGTGCCGTAAAGG + Intergenic
922070577 1:222188767-222188789 TCACCACATGTGTGTCTTGAAGG - Intergenic
923141523 1:231163959-231163981 TCACCTCGTGCTTGGCGTGCCGG - Exonic
923786236 1:237071669-237071691 TCAGGTCGTGCCTGGCTTGAAGG + Intronic
1075121264 10:119666615-119666637 TCAGCTCGTGGCTGGCTCAAGGG + Intronic
1077584892 11:3443727-3443749 TCAGTTCCTGGGTGTCTTGATGG + Intergenic
1084629967 11:70341678-70341700 CCACCTCATGGGTGCCTGGATGG + Intronic
1084830553 11:71765559-71765581 TCAGTTCCTGGGTGTCTTGATGG - Intergenic
1096351869 12:50907466-50907488 AGAGCTCTTGGGTGGCTTGATGG + Intergenic
1097198112 12:57255609-57255631 TCACCTAGTGGGAGGCTTGTAGG + Intronic
1102589689 12:113947952-113947974 ACACCTCATGGGTGGGCTGAGGG - Intronic
1106180330 13:27364152-27364174 CCACCTTATGGATGGCTTGAAGG + Intergenic
1110000292 13:70189374-70189396 TAACCTAGAGGGTGACTTGAGGG + Intergenic
1110101110 13:71604020-71604042 TCACATTGTGGGGGGCTTGATGG + Intronic
1113530330 13:111020096-111020118 CGACCTCGTGGGTGGCCTGCGGG - Intergenic
1116422700 14:44751651-44751673 TCACATAGTGGGAGGATTGAGGG + Intergenic
1116637449 14:47415826-47415848 TCACATGGTGGGAGGATTGAGGG + Intronic
1122542065 14:102504214-102504236 GCACCTGGTGGGTGGGTGGAGGG + Exonic
1128610404 15:69068422-69068444 TCACTTCGCTGGTGCCTTGAGGG + Intergenic
1134069482 16:11251950-11251972 TCAGCTCAAGGGTGGCTTGGAGG + Intronic
1138263006 16:55639097-55639119 TCCCCTCCTGGGTGGCTCCAGGG + Intergenic
1138688466 16:58746977-58746999 TCCCCACCTGGGTGACTTGATGG - Intergenic
1142190471 16:88714979-88715001 TCACCTCGTGGGTGGCTTGAGGG + Intronic
1142998888 17:3778054-3778076 TTTTCTCGTGGGTCGCTTGAAGG - Intronic
1143023426 17:3928201-3928223 TCACCTTGTGGGTGGGTCAAGGG - Intronic
1146976092 17:37113212-37113234 TTACATTGTGGATGGCTTGAGGG - Exonic
1147988082 17:44317992-44318014 TCTCCTGGGGGGTGACTTGAGGG + Intronic
1148216538 17:45836600-45836622 TCACCTGTTGGGTGGGATGAGGG - Intergenic
1148841125 17:50498082-50498104 TCACCTCCTGGGTGGCTGGGAGG + Intergenic
1153181471 18:2439849-2439871 AACCCTCGTGGGAGGCTTGAGGG - Intergenic
1156788775 18:40947401-40947423 TCACCTCAAGGGTGACTGGATGG - Intergenic
1162397875 19:10428018-10428040 TCACCTGGTGGGTGTCTGGTGGG + Intronic
1166886887 19:45967027-45967049 TCATCTTGTGGGTGGCTTGATGG + Intronic
932177584 2:69616915-69616937 GTCCCTCGTGGGTGGCTTGGGGG - Intronic
936161275 2:110085866-110085888 TCGCCTCCTGCGTGGCCTGAGGG + Intronic
936183388 2:110285488-110285510 TCGCCTCCTGCGTGGCCTGAGGG - Intergenic
937703487 2:124891219-124891241 TCACATGCTGGGTGCCTTGATGG + Intronic
938765451 2:134458144-134458166 CTCCCTCGTGGGTGGCGTGATGG - Exonic
944487310 2:200220696-200220718 TCACATTGAGGGTAGCTTGAAGG - Intergenic
946001743 2:216488197-216488219 TCACGTCGTGTGTGGCGTGATGG + Intergenic
1168842821 20:920755-920777 TCACTTGGTGGGTGGCGGGATGG - Intergenic
1175432048 20:58912183-58912205 TCACTTCCTGGGTGGCTTCCAGG + Intergenic
1175953065 20:62593733-62593755 TCACCCCATGGGTGGCATGTAGG + Intergenic
1176104925 20:63381449-63381471 TCACCTCCTGTGTGGCTCGGGGG + Intergenic
1185239555 22:49735304-49735326 TCTCCTCTTGGGTGCCCTGAGGG - Intergenic
954772238 3:52982029-52982051 TGAACTCATGGGTGGCTTGGGGG - Intronic
961527180 3:127512482-127512504 TGACCTGGTTGGTGGCTTCATGG + Intergenic
961889596 3:130119652-130119674 TCAGTTCCTGGGTGTCTTGATGG + Intergenic
962270811 3:133976775-133976797 ACAACTGGTGGGTGGCGTGAAGG + Intronic
969000086 4:3973570-3973592 TCAGTTCCTGGGTGTCTTGATGG + Intergenic
969464765 4:7349671-7349693 TCACCCAGTGGGTGGCTTTTGGG + Intronic
969753935 4:9135037-9135059 TCAGTTCCTGGGTGTCTTGATGG - Intergenic
969813825 4:9671233-9671255 TCAGTTCCTGGGTGTCTTGATGG - Intergenic
971382084 4:26108260-26108282 CCACCTCGTGGGAGGGTTCAAGG - Intergenic
973642509 4:52917496-52917518 CCACCTAGTGGGTGGGTAGATGG - Intronic
975760293 4:77613466-77613488 GCAGCTGGTGGGTGGCGTGAAGG + Intergenic
977086866 4:92610742-92610764 ACAATTCGTGGTTGGCTTGAAGG - Intronic
985521568 5:376210-376232 GGACCTCCTGGGTGGCTTCAGGG + Intronic
986613155 5:9590017-9590039 TTACTACCTGGGTGGCTTGAAGG + Intergenic
986780916 5:11064935-11064957 CCAGCTCCTAGGTGGCTTGAAGG - Intronic
988557788 5:32253064-32253086 TCCCCTCGTGGGTGGGGTGGGGG - Intronic
992645620 5:78808509-78808531 TGACCTCCTGGGTGGCTGGGAGG + Intronic
995352357 5:111194206-111194228 TCACCTACTTGGTGGGTTGATGG - Intergenic
997827093 5:137116161-137116183 TGCCATCGTGGATGGCTTGAGGG - Intronic
999664895 5:153902506-153902528 TCACCTCATGGGTTATTTGAAGG - Intergenic
1001200804 5:169714505-169714527 TCTCCATGTGGGTGGCTTCAGGG + Intronic
1004162510 6:13227512-13227534 GCTCCTCGTGGGTGGTGTGATGG - Intronic
1004183918 6:13405914-13405936 TCAACTCATCAGTGGCTTGAAGG + Intronic
1007794092 6:44333572-44333594 TGACCTCATGGGTGTCTTGGAGG + Intronic
1008657438 6:53630197-53630219 TCACGTAGTGGGTGGGTGGATGG + Intergenic
1009544993 6:65009710-65009732 AGAGCTCTTGGGTGGCTTGATGG - Intronic
1010893665 6:81341933-81341955 AGAGCTCTTGGGTGGCTTGATGG - Intergenic
1013442283 6:110182474-110182496 TCAACTAGTGGGTGGATTGTGGG - Intronic
1014162636 6:118187570-118187592 CCAGCGCGTGGGTGGCTGGAGGG + Intronic
1018645941 6:165948636-165948658 TCACCTCGATGGTTTCTTGATGG - Intronic
1018931513 6:168243069-168243091 TCACATGGTGAGTGGCTTGGAGG + Intergenic
1025873053 7:65452948-65452970 TCACCTTCTGGAGGGCTTGATGG + Intergenic
1033825338 7:145182959-145182981 TCACCTCGTGGGAGGGATGAAGG + Intergenic
1034632591 7:152542327-152542349 TAACCTTGTATGTGGCTTGAAGG - Intergenic
1036852397 8:12212763-12212785 TCAGTTCCTGGGTGTCTTGATGG + Intergenic
1036873765 8:12455286-12455308 TCAGTTCCTGGGTGTCTTGATGG + Intergenic
1037907637 8:22724805-22724827 TCACCCCGGTGGTGGCTGGAAGG + Intronic
1041885135 8:62799801-62799823 TCCACTCGTTGGTGGATTGATGG - Intronic
1047191608 8:122683511-122683533 TCACCTCATGGGTTCCTTCATGG - Intergenic
1052504366 9:29333016-29333038 TCACATCCTGGGTGGAATGAAGG + Intergenic
1056263528 9:84873423-84873445 TCATCTCGTGGGAGCCTTCATGG + Intronic
1058924911 9:109653679-109653701 TCACCTCCTGGGAAGCTTGTTGG - Intronic
1061003468 9:127915656-127915678 TCCCCTCCTGGGAGGCTTGGTGG - Intronic
1061374257 9:130214783-130214805 TCACCTCATGGGGGGCTTCTTGG + Intronic
1062027737 9:134348245-134348267 TCACCTCCTGGGAGGCTTCCAGG - Intronic
1191166889 X:57401152-57401174 AGACCACTTGGGTGGCTTGATGG + Intronic
1191602647 X:63026767-63026789 TCCCCTCCTGGCTGGCTTCATGG + Intergenic