ID: 1142190471

View in Genome Browser
Species Human (GRCh38)
Location 16:88714979-88715001
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 86}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142190455_1142190471 18 Left 1142190455 16:88714938-88714960 CCCACCTGTCCTGGGCCGGGCTT 0: 1
1: 0
2: 2
3: 10
4: 155
Right 1142190471 16:88714979-88715001 TCACCTCGTGGGTGGCTTGAGGG 0: 1
1: 0
2: 1
3: 5
4: 86
1142190461_1142190471 9 Left 1142190461 16:88714947-88714969 CCTGGGCCGGGCTTGGGGACGCG 0: 1
1: 0
2: 3
3: 27
4: 278
Right 1142190471 16:88714979-88715001 TCACCTCGTGGGTGGCTTGAGGG 0: 1
1: 0
2: 1
3: 5
4: 86
1142190456_1142190471 17 Left 1142190456 16:88714939-88714961 CCACCTGTCCTGGGCCGGGCTTG 0: 1
1: 0
2: 0
3: 20
4: 258
Right 1142190471 16:88714979-88715001 TCACCTCGTGGGTGGCTTGAGGG 0: 1
1: 0
2: 1
3: 5
4: 86
1142190464_1142190471 3 Left 1142190464 16:88714953-88714975 CCGGGCTTGGGGACGCGGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1142190471 16:88714979-88715001 TCACCTCGTGGGTGGCTTGAGGG 0: 1
1: 0
2: 1
3: 5
4: 86
1142190459_1142190471 14 Left 1142190459 16:88714942-88714964 CCTGTCCTGGGCCGGGCTTGGGG 0: 1
1: 0
2: 3
3: 47
4: 439
Right 1142190471 16:88714979-88715001 TCACCTCGTGGGTGGCTTGAGGG 0: 1
1: 0
2: 1
3: 5
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type