ID: 1142192102

View in Genome Browser
Species Human (GRCh38)
Location 16:88722766-88722788
Sequence ACTAGGCTGTTAAGCAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142192090_1142192102 20 Left 1142192090 16:88722723-88722745 CCAGCTCTTGTCCCCACACGGGG 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1142192102 16:88722766-88722788 ACTAGGCTGTTAAGCAGGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 105
1142192093_1142192102 8 Left 1142192093 16:88722735-88722757 CCCACACGGGGTTTCGTGCAGTG 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1142192102 16:88722766-88722788 ACTAGGCTGTTAAGCAGGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 105
1142192094_1142192102 7 Left 1142192094 16:88722736-88722758 CCACACGGGGTTTCGTGCAGTGG 0: 1
1: 0
2: 0
3: 2
4: 68
Right 1142192102 16:88722766-88722788 ACTAGGCTGTTAAGCAGGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 105
1142192092_1142192102 9 Left 1142192092 16:88722734-88722756 CCCCACACGGGGTTTCGTGCAGT 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1142192102 16:88722766-88722788 ACTAGGCTGTTAAGCAGGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142192102 Original CRISPR ACTAGGCTGTTAAGCAGGCA GGG Intronic
903456643 1:23491943-23491965 AATAGGCTGTAGAGCAGCCAGGG - Intergenic
903498769 1:23790591-23790613 ACAAAGCTGTGAAGGAGGCAGGG + Intergenic
906314152 1:44775654-44775676 AGTAGGCTGTGAAGCAGGATGGG - Intronic
906499746 1:46333016-46333038 ACTAGGAGGTTAAACAAGCAAGG - Intergenic
911036322 1:93552844-93552866 AACAGGATGTTAAGCAAGCACGG - Exonic
916640323 1:166721445-166721467 ACTTAGCTGTAAAGCAGGCAAGG - Intergenic
919333567 1:196203670-196203692 ATAAGGCTGTTATGCAGGAAAGG - Intergenic
922348023 1:224713064-224713086 ACAAGGATGTTAAGCATGCTTGG - Intronic
1063858724 10:10285099-10285121 ACTAGAAAGTTAAACAGGCAGGG - Intergenic
1074038555 10:109765303-109765325 ACTAGGCTGCAAACTAGGCATGG + Intergenic
1074140024 10:110664095-110664117 TCTAGGCTGTTCAGTAGACAAGG - Intronic
1074781825 10:116807782-116807804 ACTAAGCTGTAGACCAGGCATGG + Intergenic
1074859232 10:117497680-117497702 ACTAGGTTGATCAGCTGGCATGG - Intergenic
1080146226 11:28987355-28987377 ATTATGCTGTCAAGCAGACATGG - Intergenic
1082913323 11:58402339-58402361 AATAGACTTTTAAACAGGCATGG + Intergenic
1084389997 11:68869136-68869158 AATAAGCTGTTAAACAGGCCTGG - Intergenic
1086402676 11:86473426-86473448 GCTTGGCTGTGAAGTAGGCAGGG + Intronic
1089392008 11:118108600-118108622 GCTGGGCTTTGAAGCAGGCAGGG + Intronic
1090342026 11:126032518-126032540 CAAAGGCTTTTAAGCAGGCAAGG + Intronic
1090899705 11:131017662-131017684 ACTAGGATTTAAAGCAGGGAAGG - Intergenic
1092124201 12:6064311-6064333 ACAAGGCTGTTGTGCAGGCCAGG + Exonic
1093293221 12:17354901-17354923 AATAAGCTGTAAAGTAGGCAAGG - Intergenic
1093908670 12:24721447-24721469 ACTAGGCTTTAAAGAAAGCAGGG - Intergenic
1097852613 12:64427441-64427463 ACTTGGCTGATGAGCAGGAAAGG - Intronic
1098098540 12:66987418-66987440 AGTAGGTTGATAAGAAGGCAAGG - Intergenic
1103377162 12:120466221-120466243 AGTAGGCGGTTAGCCAGGCATGG + Intronic
1106901830 13:34361594-34361616 ACGAGGCTGGAAAGCAGGCTGGG + Intergenic
1109402929 13:61858354-61858376 ACTATGCTGTTTAGAAGTCAGGG + Intergenic
1110460598 13:75740692-75740714 ACTAGGCATGTAATCAGGCAAGG - Intronic
1110948786 13:81458858-81458880 ACTAGGCTTTTCAGCAGAAAAGG + Intergenic
1113764744 13:112874286-112874308 ACCAGGCTGCAGAGCAGGCATGG + Intronic
1114860379 14:26511200-26511222 ACAAGGCTGTGCAACAGGCATGG + Intronic
1114867037 14:26608431-26608453 ACTAGTATGTGAAGCAGGGAGGG + Intergenic
1116649117 14:47566664-47566686 ATGAGTGTGTTAAGCAGGCATGG - Intronic
1117758124 14:58997780-58997802 AATAGGCTGTACAGGAGGCATGG - Intergenic
1120328474 14:83057599-83057621 ACTAAGAAGTTAAACAGGCAAGG - Intergenic
1121112490 14:91321696-91321718 TCTCGGCTGCTCAGCAGGCAGGG + Intronic
1125338337 15:38650564-38650586 ACTAGGCTGTTAGGCTGCCTAGG + Intergenic
1125393081 15:39216058-39216080 ACAAAACTGTGAAGCAGGCAAGG + Intergenic
1125438007 15:39668737-39668759 ACTAGTGTGGTAAGCAAGCAAGG - Intronic
1141122676 16:81373190-81373212 TCTATGCTGTGAAGCAGCCAGGG - Intronic
1142192102 16:88722766-88722788 ACTAGGCTGTTAAGCAGGCAGGG + Intronic
1149481269 17:57005269-57005291 ACGAGGCTGGTAGGAAGGCATGG + Intronic
1150497650 17:65620899-65620921 ACTAAGCTGTTCAGCAAGAAGGG + Intronic
1157628520 18:49072892-49072914 ACTAGGCTCTTAAACCTGCAGGG + Intronic
1163847209 19:19644320-19644342 CTTTGGCTGTTAAGGAGGCAAGG + Intergenic
1166131267 19:40747126-40747148 CCAAGGCTGGTAAGAAGGCAAGG + Intronic
926357993 2:12058772-12058794 TCTACTCTGTTAAGAAGGCAAGG - Intergenic
927361587 2:22241252-22241274 ATTGAGCTGTTAATCAGGCAAGG - Intergenic
936558019 2:113512569-113512591 ACTACTCTGTTAAACAGTCAAGG + Intergenic
937781126 2:125838439-125838461 ACTAGGAAGTTAGGCAGGCATGG - Intergenic
938374272 2:130795571-130795593 CCCTGGCTGCTAAGCAGGCAAGG - Intergenic
942577361 2:177378373-177378395 ACAAGGCTGTTAACCAGCCTCGG - Intronic
943239841 2:185368458-185368480 ACTAGGATTTTAGGCAGGAAGGG - Intergenic
944261110 2:197678212-197678234 ACTAAGCTGTAAGGGAGGCAAGG + Intergenic
944971879 2:205002655-205002677 AATAGGCTGTGGAGCAGGCAGGG - Intronic
945328383 2:208510614-208510636 AATAGGCTGCTCAGCAGACAGGG - Intronic
948118901 2:235514433-235514455 ACCAGGCTGGAGAGCAGGCAGGG - Intronic
1172055276 20:32150465-32150487 ACTATGCTGTTGAGAAGACAAGG + Intronic
1176244079 20:64089096-64089118 CCTAGGCTGTTCAGCATGCCAGG + Intronic
1179992917 21:44957915-44957937 CCTAGGATGTGAAGCAGACAGGG + Intronic
1182728741 22:32470493-32470515 ACTAGAATGTTTAGCAGGCCAGG + Intergenic
949748026 3:7317634-7317656 GCTAGGGTGCTAAGTAGGCATGG + Intronic
951906204 3:27710296-27710318 ATTTGGTTGTTAAGCAGGGAGGG - Intergenic
954758910 3:52860229-52860251 ACTAGGGTGTGATGAAGGCAAGG - Intronic
956816210 3:72910780-72910802 ACTAGCCAGTTAAACATGCATGG - Intronic
959601001 3:108185677-108185699 ACTAGGATTTAAAGCAGGAAGGG + Intronic
960174152 3:114497374-114497396 ATTGGGCTGGAAAGCAGGCAGGG - Intronic
964691324 3:159453295-159453317 ACAAGCCTGTGATGCAGGCATGG - Intronic
964800643 3:160553619-160553641 ACTAGGCTTTTAAGAATGCAAGG - Intronic
968864573 4:3199761-3199783 ACTAGGCTGTTCCGCAGTGATGG + Exonic
970433526 4:16011075-16011097 GCCAGGCTGAGAAGCAGGCAGGG - Intronic
971138373 4:23896346-23896368 CCCAGTATGTTAAGCAGGCATGG - Intronic
977233397 4:94478744-94478766 ATTAGGCTATTAAGCAGAAATGG + Intronic
978319543 4:107478845-107478867 AATAGGCAGTTTAGAAGGCAGGG - Intergenic
980831505 4:138134099-138134121 AGTAGGCTCTGAGGCAGGCAAGG + Intergenic
983268493 4:165533100-165533122 AGTGGGTTGTTAAGCAGGCTGGG + Intergenic
984657881 4:182339459-182339481 TTTTGGCTGTTAAGTAGGCAAGG + Intronic
988540037 5:32100362-32100384 CCTTGGCTGGTAGGCAGGCAAGG + Intronic
990676447 5:58191614-58191636 ATTAGGCAGTGAACCAGGCATGG + Intergenic
992286134 5:75237147-75237169 CCAAGGGTGTTAAGCAGGCTCGG - Intergenic
992626514 5:78640726-78640748 CCAACCCTGTTAAGCAGGCAAGG + Intronic
997714892 5:136035159-136035181 GCTGGGCTGTCAATCAGGCATGG - Intronic
1002525276 5:179812194-179812216 TCAAGGCTGTTATGCATGCAGGG + Intronic
1003558989 6:7165688-7165710 ACTGGGCAGATGAGCAGGCAGGG + Intronic
1007742982 6:44024045-44024067 ACAAGGCTGACAAGCAGCCAAGG + Intergenic
1010296726 6:74207117-74207139 ACCAGGCTGTCAAGTAGCCATGG + Intergenic
1018970314 6:168523790-168523812 ACAAGGCTGTTAAACAGTTAGGG + Intronic
1020899836 7:13990648-13990670 ACTAGGACGTTAAGCAGTGAGGG + Intronic
1026171935 7:67961628-67961650 ACTAGGCTTAAAAGCAGGCCGGG + Intergenic
1026437850 7:70415343-70415365 ACTGTGCTGTTAGGCAAGCAGGG - Intronic
1031700591 7:124919998-124920020 ATTCAGCTGTTAAGGAGGCAAGG - Intronic
1032019107 7:128396741-128396763 AAGAGGCTGTTGGGCAGGCAGGG - Intronic
1032394203 7:131577481-131577503 ACTAGGCTGTGGAGCAGGGTGGG - Intergenic
1037522266 8:19691660-19691682 ACAAGGCTAGGAAGCAGGCATGG - Intronic
1037640140 8:20734794-20734816 ACGAGGCTGTCAACAAGGCAGGG + Intergenic
1041317737 8:56581920-56581942 AGGAGGCTTTTGAGCAGGCAAGG + Intergenic
1045071929 8:98515338-98515360 ACTAGTCTGTTCAGCAGACATGG + Intronic
1046558899 8:115813836-115813858 TCTAGGCTGTGGAGCAGGGAGGG + Intergenic
1047436153 8:124836842-124836864 ACTAGGCTAAAATGCAGGCAGGG + Intergenic
1047638430 8:126792495-126792517 ACTATGCTGTTGAGAAGTCAAGG + Intergenic
1047763638 8:127972301-127972323 ACTGGGCTGAGCAGCAGGCAGGG + Intergenic
1049894837 9:103692-103714 ACTACGCTGTTAAACAGTCAAGG - Intergenic
1051404268 9:16718178-16718200 ACCAGGCTGACAGGCAGGCAGGG + Intronic
1053736047 9:41103688-41103710 ACTACTCTGTTAAACAGTCAAGG - Intergenic
1054692326 9:68327711-68327733 ACTACTCTGTTAAACAGTCAAGG + Intergenic
1054922465 9:70555771-70555793 ACTAGACTGTTAGGCTGGGAGGG - Intronic
1060484428 9:124038138-124038160 ACTAGGCATTCAAGAAGGCAAGG + Intergenic
1061386314 9:130291937-130291959 ACTAAGCTGTTCAAGAGGCATGG + Intronic
1186748460 X:12595558-12595580 ACTATGCTATTAAGCATGTATGG + Intronic
1188378827 X:29466800-29466822 ACAATGCTGTGAAGTAGGCAGGG + Intronic
1189129360 X:38482110-38482132 ACTAGGCTGAAAAGCAGGCTGGG + Intronic
1194122738 X:89979825-89979847 GTGAGGGTGTTAAGCAGGCATGG - Intergenic
1194144632 X:90247035-90247057 ACTTCCCTGTTAAGCAGGCATGG - Intergenic
1200490388 Y:3816340-3816362 ACTTCCCTGTTAAGCAGGCATGG - Intergenic