ID: 1142194475

View in Genome Browser
Species Human (GRCh38)
Location 16:88733130-88733152
Sequence GGGGCGCCAAGGGGGCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142194475_1142194487 7 Left 1142194475 16:88733130-88733152 CCAGGAAGCCCCCTTGGCGCCCC 0: 1
1: 0
2: 1
3: 30
4: 261
Right 1142194487 16:88733160-88733182 GAGTCCTCCATCTCCATTGCTGG 0: 1
1: 0
2: 1
3: 21
4: 110
1142194475_1142194491 23 Left 1142194475 16:88733130-88733152 CCAGGAAGCCCCCTTGGCGCCCC 0: 1
1: 0
2: 1
3: 30
4: 261
Right 1142194491 16:88733176-88733198 TTGCTGGCCCCACTGCACTGAGG 0: 1
1: 0
2: 4
3: 17
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142194475 Original CRISPR GGGGCGCCAAGGGGGCTTCC TGG (reversed) Intronic