ID: 1142194483

View in Genome Browser
Species Human (GRCh38)
Location 16:88733149-88733171
Sequence GATGGAGGACTCTCCCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 155}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142194483_1142194499 26 Left 1142194483 16:88733149-88733171 CCCCCAGGGGAGAGTCCTCCATC 0: 1
1: 0
2: 1
3: 11
4: 155
Right 1142194499 16:88733198-88733220 GCAGCTGCCCCAGGAGGGTCGGG 0: 1
1: 0
2: 2
3: 69
4: 491
1142194483_1142194497 21 Left 1142194483 16:88733149-88733171 CCCCCAGGGGAGAGTCCTCCATC 0: 1
1: 0
2: 1
3: 11
4: 155
Right 1142194497 16:88733193-88733215 CTGAGGCAGCTGCCCCAGGAGGG 0: 1
1: 0
2: 1
3: 69
4: 453
1142194483_1142194491 4 Left 1142194483 16:88733149-88733171 CCCCCAGGGGAGAGTCCTCCATC 0: 1
1: 0
2: 1
3: 11
4: 155
Right 1142194491 16:88733176-88733198 TTGCTGGCCCCACTGCACTGAGG 0: 1
1: 0
2: 4
3: 17
4: 256
1142194483_1142194498 25 Left 1142194483 16:88733149-88733171 CCCCCAGGGGAGAGTCCTCCATC 0: 1
1: 0
2: 1
3: 11
4: 155
Right 1142194498 16:88733197-88733219 GGCAGCTGCCCCAGGAGGGTCGG 0: 1
1: 0
2: 3
3: 67
4: 455
1142194483_1142194495 17 Left 1142194483 16:88733149-88733171 CCCCCAGGGGAGAGTCCTCCATC 0: 1
1: 0
2: 1
3: 11
4: 155
Right 1142194495 16:88733189-88733211 TGCACTGAGGCAGCTGCCCCAGG 0: 1
1: 0
2: 1
3: 30
4: 328
1142194483_1142194496 20 Left 1142194483 16:88733149-88733171 CCCCCAGGGGAGAGTCCTCCATC 0: 1
1: 0
2: 1
3: 11
4: 155
Right 1142194496 16:88733192-88733214 ACTGAGGCAGCTGCCCCAGGAGG 0: 1
1: 0
2: 6
3: 40
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142194483 Original CRISPR GATGGAGGACTCTCCCCTGG GGG (reversed) Intronic
901295244 1:8156233-8156255 AATGGAGGAATCTTCTCTGGAGG + Intergenic
901824937 1:11855055-11855077 GATGGAGGTCCCCCTCCTGGTGG - Intergenic
902451424 1:16499126-16499148 GAAGGAGGCCGCTCGCCTGGGGG - Intergenic
902821905 1:18948597-18948619 GTGGGAGGACACTCCCCTCGTGG + Intronic
903261322 1:22133242-22133264 GATGGAGGGCTCTGTCCTGACGG + Intronic
909931400 1:81503432-81503454 GGTGGAGGGCTCTGCGCTGGGGG - Intronic
914404544 1:147357989-147358011 GATGGCCGCCTCTCCCCTGAGGG - Intergenic
914740946 1:150464520-150464542 GATGCAGGACTGACCCCTGGTGG - Exonic
916921823 1:169477160-169477182 TATGGAGGAGCCTCCCGTGGAGG - Exonic
920212396 1:204337699-204337721 GATGGCGGTCTCTCACTTGGGGG + Intronic
921218330 1:212955383-212955405 ACTGCAGGCCTCTCCCCTGGAGG + Intronic
1063117811 10:3084706-3084728 GCTGGAGGACTCTCCTGGGGAGG - Intronic
1063117820 10:3084730-3084752 GCTGGAGGACTCTCCTGGGGAGG - Intronic
1063117829 10:3084754-3084776 GGTGGAGGACTCTCCTGGGGAGG - Intronic
1063117839 10:3084778-3084800 GATGGAGGACTCTCCTGGGGAGG - Intronic
1067747400 10:48946267-48946289 AATAGAGGACTCTAACCTGGTGG + Intronic
1070627810 10:78063606-78063628 GATGGTGAAGTCTCCCCTGTGGG + Intergenic
1070811111 10:79298574-79298596 GAGGGAGGGCCCTCACCTGGGGG - Exonic
1071876873 10:89851987-89852009 GATCAAGGACTCTCTCCTGGTGG + Intergenic
1074881706 10:117664814-117664836 GATGGATGACTCTCCCGCAGAGG - Intergenic
1075086641 10:119418313-119418335 GGTGAAGGACTCTCCCCTTCTGG - Intronic
1076110565 10:127856190-127856212 TCTGGAGGCCGCTCCCCTGGGGG - Intergenic
1077011803 11:382146-382168 GGTAGAGTCCTCTCCCCTGGGGG + Intergenic
1078479778 11:11665513-11665535 GAGGCAGGACTCTACTCTGGAGG + Intergenic
1078848442 11:15142314-15142336 GCTGGAGCACTCTGGCCTGGTGG - Intronic
1081483779 11:43512061-43512083 GGTGGAGCACTCTCTCCTGTGGG + Intergenic
1082835354 11:57647113-57647135 GCTGGAGGACAATGCCCTGGTGG + Exonic
1084564097 11:69919897-69919919 GAAGGAGGACTCACCCCAGGAGG - Intergenic
1084564277 11:69920525-69920547 GAGGGAGGACTCACCCCAGGAGG - Intergenic
1084616068 11:70236685-70236707 GATGGATCCCTCTCTCCTGGAGG - Intergenic
1084669589 11:70597214-70597236 CAGGGAGGAGTTTCCCCTGGCGG - Intronic
1085519285 11:77128671-77128693 GATGGATGTGTGTCCCCTGGAGG + Intronic
1087408832 11:97765054-97765076 CAAGGAGGACTCCCCCCTGAGGG - Intergenic
1088015582 11:105055039-105055061 GAGGGAGGACCTTCTCCTGGGGG + Intronic
1088228555 11:107648503-107648525 GATGGTGGACTTTACACTGGAGG - Intronic
1088885249 11:114001043-114001065 GGTGGAGAAGTCTTCCCTGGAGG + Intergenic
1089054799 11:115576919-115576941 GATTCAGGATTCACCCCTGGAGG + Intergenic
1089352948 11:117831757-117831779 GATGGAGGCCTCGCCACTGAGGG - Intronic
1090805309 11:130198648-130198670 GTTGGGGGCCTCGCCCCTGGAGG + Intronic
1090869910 11:130735080-130735102 GCTTGAGGACTCTCACATGGTGG + Intergenic
1094169144 12:27473275-27473297 GAAGAAGGATTCTCTCCTGGAGG - Intronic
1097118505 12:56716662-56716684 GATGGAGGAGTCACAGCTGGAGG + Intronic
1103620226 12:122183047-122183069 GATGGGGGACTTTTCCCTCGGGG + Intronic
1104720660 12:131043517-131043539 CATGCAGGCCTCTCCCCTGCAGG + Intronic
1110872738 13:80471415-80471437 GATGGTGGACTCTGCCCATGAGG + Intergenic
1113043802 13:106132254-106132276 GATGGTGAACTCTTCTCTGGAGG - Intergenic
1113768844 13:112895965-112895987 GAGGGGGGCCCCTCCCCTGGGGG + Intronic
1113901602 13:113801065-113801087 GATGGAGGCCTCACCCCTGCAGG - Intronic
1114459507 14:22877544-22877566 TACTGAGGCCTCTCCCCTGGGGG + Exonic
1118348313 14:64955723-64955745 GACAGAGGACTCTTCCCTGAGGG - Intronic
1119133864 14:72198745-72198767 GCAGGTGGACTCTGCCCTGGAGG - Intronic
1122135981 14:99633256-99633278 GTTGGCGCACCCTCCCCTGGGGG - Intergenic
1122369749 14:101222934-101222956 GCAGGAGGACTGTCCCCAGGAGG - Intergenic
1127119592 15:55759544-55759566 GATGGAGGCCTCTGGCCAGGAGG - Intergenic
1127287600 15:57544950-57544972 GAAGGCTGACTCTGCCCTGGCGG + Intronic
1127453873 15:59140770-59140792 GGTGGTGGACTGTCCCCAGGAGG + Intronic
1129163637 15:73762368-73762390 GAAGGAGGACATCCCCCTGGGGG - Intergenic
1129295064 15:74595737-74595759 GGTGGAGGGCTCTGCGCTGGGGG - Exonic
1132241568 15:100261501-100261523 GAAGGACGACCCGCCCCTGGTGG - Exonic
1132570284 16:641347-641369 GCTGGAGGTCTCTCTGCTGGGGG - Intronic
1134628425 16:15739494-15739516 GAAGGAGGACCCTTCCCTTGTGG - Intronic
1136366610 16:29812009-29812031 GAAGGAGGCGTCTCTCCTGGAGG + Intronic
1138168396 16:54824939-54824961 GAAGGAGGTCTCTTTCCTGGAGG + Intergenic
1139340120 16:66262973-66262995 GAGGAGGGATTCTCCCCTGGAGG - Intergenic
1140600681 16:76471569-76471591 GATGGAGGACGGTGCCATGGAGG - Intronic
1141788475 16:86217260-86217282 GGGTGAGGACTCTGCCCTGGGGG + Intergenic
1142103138 16:88286098-88286120 GATGGAGCACATTCCCCTGTTGG + Intergenic
1142194483 16:88733149-88733171 GATGGAGGACTCTCCCCTGGGGG - Intronic
1142371718 16:89686395-89686417 CATGAAGGACTCCCACCTGGAGG + Intronic
1143032562 17:3976100-3976122 GCTGGAGCCCTCTCCCCTGCTGG - Intergenic
1143470834 17:7174161-7174183 GCTGGAGGACGCGCACCTGGTGG - Exonic
1143699985 17:8651259-8651281 GATGCAGGACACAGCCCTGGGGG - Intergenic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1148214133 17:45825263-45825285 GTTGGGGGCCTGTCCCCTGGTGG - Intronic
1148490846 17:48023452-48023474 GATGGATGGCTCCCCGCTGGCGG - Intergenic
1148960737 17:51390739-51390761 CATGGAGAACGCTCCCCTGAAGG - Intergenic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1157290802 18:46408154-46408176 GGTTGAGGAGTCTGCCCTGGAGG + Intronic
1160129426 18:76211398-76211420 GGTGGAGGAGTCTCCCCTCGGGG - Intergenic
1160272843 18:77403542-77403564 GATGGGTGAGTCTCCCTTGGAGG - Intergenic
1161078885 19:2300664-2300686 GAGGGAGGACTCTGGCCTGTGGG - Intronic
1163591393 19:18196076-18196098 GATGCAAGACTGTCTCCTGGCGG + Exonic
1165953617 19:39488576-39488598 GCTGGAGCACTATGCCCTGGAGG + Exonic
1166155085 19:40905016-40905038 GATGGAGCACTCTTCCCTGCTGG - Intergenic
1166172991 19:41045300-41045322 GATGGAGCACTCTTCCCTGCTGG + Intergenic
1166305568 19:41935250-41935272 GATTGAGGACTCGACCTTGGTGG + Intergenic
1166689164 19:44812527-44812549 GATGGAGGACTCTGCCCAGGAGG + Exonic
1167410518 19:49341262-49341284 GCTGGAGGACCCTCCCTGGGAGG + Exonic
1167693998 19:51003363-51003385 GATGGAGGACTCTCGGATGTTGG - Intronic
1167725019 19:51205579-51205601 GAGGGAGGAGTCTCACATGGCGG - Intergenic
925070167 2:960497-960519 GACAGAGGACTCTGCCCTCGTGG + Intronic
927755062 2:25701900-25701922 GATGGGTGACTGTCACCTGGTGG + Intergenic
931632218 2:64311520-64311542 GCTGGAGGAGGTTCCCCTGGCGG - Intergenic
931634074 2:64326494-64326516 GATGCAGCACTCAGCCCTGGGGG - Intergenic
933261183 2:80133250-80133272 GAGGAAGGATTCTCCCCTAGAGG + Intronic
937118498 2:119426408-119426430 GATAGAAGTCTCTCCCGTGGGGG + Intergenic
942896119 2:181056564-181056586 GAGTGAGGACTCACCCCTGAGGG + Intronic
945044553 2:205770545-205770567 GATGGGGGACCTTACCCTGGTGG - Intronic
946339652 2:219059296-219059318 GGTGAAGGTCTCTCCCCTCGCGG + Intronic
948600271 2:239103915-239103937 TCTGGAGGTCTCTCCCCTGTGGG - Intronic
1168786614 20:544892-544914 GATGGAGCCCTGTCCACTGGGGG - Intergenic
1170931741 20:20774721-20774743 AAGGGAGGATTCTCCCCTGCAGG - Intergenic
1171183228 20:23106330-23106352 GCTGGAGGCCTCACACCTGGTGG - Intergenic
1172039676 20:32035050-32035072 GATGGACGCCTCTCCCAAGGTGG + Intergenic
1172109245 20:32535923-32535945 GCTGCAGGACTCTGGCCTGGCGG + Intronic
1174687486 20:52469511-52469533 CATGGAGAACTGTCTCCTGGGGG + Intergenic
1175887151 20:62298716-62298738 GATGGACCCCCCTCCCCTGGCGG + Intergenic
1179440346 21:41388961-41388983 GAAGGATGACTCTGCCATGGTGG - Intronic
1179840043 21:44066336-44066358 GATAGAGGCCTCTGCCCTGTGGG + Intronic
1181785793 22:25225687-25225709 GATGTAGGAATGTCCGCTGGTGG + Intronic
1185039139 22:48495539-48495561 GATGGAGGAGCCTCCCCAGATGG - Intronic
1185166933 22:49267093-49267115 GATGGAGGACTCCCTGCTGTAGG - Intergenic
950702496 3:14759941-14759963 GCAGGAGGACCCTCCCCTGATGG + Exonic
950799861 3:15541733-15541755 GAAGAAGAACTCTCCCCTGATGG + Intergenic
952898458 3:38094713-38094735 AATGGAGGACCCTCCAATGGAGG - Intronic
953446874 3:42975969-42975991 GATGGAGGAAACTGCCCTGAAGG + Intronic
954128986 3:48550167-48550189 GATGTAGGTCTTGCCCCTGGCGG + Exonic
954456216 3:50601136-50601158 GGTGGAGGACACGCCCCAGGGGG - Intergenic
960811779 3:121633143-121633165 GATGGAGGAGTCCCAACTGGAGG + Exonic
976314800 4:83647997-83648019 GACTGTGGACTCTCTCCTGGGGG + Intergenic
978564925 4:110071588-110071610 CATGGAGGAATCCCCCCTGCTGG - Intronic
984634275 4:182093782-182093804 GATGGATGACTCAGCCCTGGAGG - Intergenic
985379089 4:189373437-189373459 CTTTGAGGACTCTCCCCAGGAGG + Intergenic
985785239 5:1889856-1889878 CCTGGAGGACACTCCCCTGCAGG - Intergenic
997239726 5:132297412-132297434 GATGGATGGCTCTCCCCCAGAGG + Intronic
998469764 5:142374621-142374643 GATGGAGGTCTTTCCACTTGTGG + Intergenic
998537971 5:142951951-142951973 GAGGAAGGATTCTTCCCTGGAGG - Intronic
998967740 5:147559052-147559074 TATGGAGGACTGCCCCCTGGGGG + Intergenic
1001277088 5:170358941-170358963 GCTGGGGGACTCTCTGCTGGTGG - Intronic
1002470033 5:179429666-179429688 GTTGGATGACGCTCCCATGGTGG - Intergenic
1002470065 5:179429838-179429860 GTTGGATGACGCTCCCATGGTGG - Intergenic
1008001159 6:46361193-46361215 CATGGAGAACTCTATCCTGGGGG + Intronic
1010185110 6:73134826-73134848 GATGGAGGAGTGTCCCGTGTTGG - Intronic
1016894460 6:149038502-149038524 GAGGAAGGATTCTCCCCTCGAGG + Intronic
1019635902 7:2075392-2075414 GACGGCGGGCTCTCCCCTGTTGG + Intronic
1022479177 7:30731941-30731963 GATGGAAGACTTTCTCATGGAGG - Intronic
1023012669 7:35937785-35937807 CATGGAGGAATATCCCCTCGCGG - Intergenic
1023995910 7:45158683-45158705 GATGGAGGGCCCTGGCCTGGTGG + Intronic
1031974419 7:128084802-128084824 AATGCAGAACTCTCCCCTGCGGG - Exonic
1033013208 7:137644347-137644369 AATGGAGGCCTATGCCCTGGAGG + Intronic
1033635227 7:143205859-143205881 GAGGGAGGACTCGCTGCTGGAGG + Intergenic
1039375067 8:37024749-37024771 GATGGAAGACTCTCCTCTCCAGG - Intergenic
1040110481 8:43564998-43565020 GGTGCATGTCTCTCCCCTGGGGG - Intergenic
1040275411 8:46011318-46011340 GATGCATGTCTCTCCCATGGGGG - Intergenic
1041982405 8:63877661-63877683 GAGGGAGGAATCCCCACTGGAGG + Intergenic
1041998989 8:64099677-64099699 GATGGAAGATTCTGCCATGGAGG - Intergenic
1049989881 9:980876-980898 GTCCGAGGACACTCCCCTGGAGG - Intronic
1053297439 9:36924944-36924966 GATGGAGGACACACCCATGTTGG + Intronic
1057570615 9:96201654-96201676 CTTAGAGGACTCTTCCCTGGGGG - Intergenic
1057631803 9:96725311-96725333 TATGGGGGACTCTCCCCTTATGG + Intergenic
1060103651 9:120860379-120860401 CCTGGAGCACCCTCCCCTGGCGG + Intronic
1060811041 9:126611685-126611707 GAACGAGGACTCTCGCCTGCAGG + Intergenic
1185552797 X:997502-997524 GATGGAGGATTCTCCGCGGTGGG - Intergenic
1187255123 X:17635363-17635385 CATCTAGGACTCCCCCCTGGAGG - Intronic
1191961067 X:66702859-66702881 GAGGGAGGAATCACTCCTGGTGG - Intergenic
1197237428 X:124083455-124083477 GGTGGATGGCTCTCCCCTTGCGG - Exonic