ID: 1142194672

View in Genome Browser
Species Human (GRCh38)
Location 16:88733905-88733927
Sequence CAGGCCACGCAGGTGCCTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 260}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142194672_1142194681 12 Left 1142194672 16:88733905-88733927 CCTTCAGGCACCTGCGTGGCCTG 0: 1
1: 0
2: 3
3: 27
4: 260
Right 1142194681 16:88733940-88733962 CACGCCCAGCCCCTCGTCCCTGG 0: 1
1: 0
2: 6
3: 36
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142194672 Original CRISPR CAGGCCACGCAGGTGCCTGA AGG (reversed) Exonic