ID: 1142196181

View in Genome Browser
Species Human (GRCh38)
Location 16:88740296-88740318
Sequence CTGTCCACGCTGGCCGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142196173_1142196181 14 Left 1142196173 16:88740259-88740281 CCTGCAGGTGCCTGGTGCCCCCA 0: 1
1: 0
2: 3
3: 40
4: 328
Right 1142196181 16:88740296-88740318 CTGTCCACGCTGGCCGCCCAGGG No data
1142196177_1142196181 -5 Left 1142196177 16:88740278-88740300 CCCAGCTCACTCTGAAGTCTGTC 0: 1
1: 0
2: 3
3: 19
4: 225
Right 1142196181 16:88740296-88740318 CTGTCCACGCTGGCCGCCCAGGG No data
1142196178_1142196181 -6 Left 1142196178 16:88740279-88740301 CCAGCTCACTCTGAAGTCTGTCC 0: 1
1: 1
2: 2
3: 22
4: 224
Right 1142196181 16:88740296-88740318 CTGTCCACGCTGGCCGCCCAGGG No data
1142196175_1142196181 -3 Left 1142196175 16:88740276-88740298 CCCCCAGCTCACTCTGAAGTCTG No data
Right 1142196181 16:88740296-88740318 CTGTCCACGCTGGCCGCCCAGGG No data
1142196176_1142196181 -4 Left 1142196176 16:88740277-88740299 CCCCAGCTCACTCTGAAGTCTGT 0: 1
1: 0
2: 2
3: 30
4: 214
Right 1142196181 16:88740296-88740318 CTGTCCACGCTGGCCGCCCAGGG No data
1142196174_1142196181 4 Left 1142196174 16:88740269-88740291 CCTGGTGCCCCCAGCTCACTCTG 0: 1
1: 0
2: 3
3: 56
4: 404
Right 1142196181 16:88740296-88740318 CTGTCCACGCTGGCCGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142196181 Original CRISPR CTGTCCACGCTGGCCGCCCA GGG Intronic
No off target data available for this crispr