ID: 1142196954

View in Genome Browser
Species Human (GRCh38)
Location 16:88743358-88743380
Sequence AAGCTCCTGCCAGCACGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142196954_1142196966 27 Left 1142196954 16:88743358-88743380 CCGGCACGTGCTGGCAGGAGCTT 0: 1
1: 1
2: 1
3: 16
4: 148
Right 1142196966 16:88743408-88743430 CCTGCACCACCAGCCACGCCCGG 0: 1
1: 0
2: 1
3: 36
4: 343
1142196954_1142196958 -5 Left 1142196954 16:88743358-88743380 CCGGCACGTGCTGGCAGGAGCTT 0: 1
1: 1
2: 1
3: 16
4: 148
Right 1142196958 16:88743376-88743398 AGCTTCCGGGCCCTCACCCTGGG No data
1142196954_1142196957 -6 Left 1142196954 16:88743358-88743380 CCGGCACGTGCTGGCAGGAGCTT 0: 1
1: 1
2: 1
3: 16
4: 148
Right 1142196957 16:88743375-88743397 GAGCTTCCGGGCCCTCACCCTGG 0: 1
1: 0
2: 1
3: 16
4: 205
1142196954_1142196959 -4 Left 1142196954 16:88743358-88743380 CCGGCACGTGCTGGCAGGAGCTT 0: 1
1: 1
2: 1
3: 16
4: 148
Right 1142196959 16:88743377-88743399 GCTTCCGGGCCCTCACCCTGGGG 0: 1
1: 0
2: 1
3: 16
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142196954 Original CRISPR AAGCTCCTGCCAGCACGTGC CGG (reversed) Intronic
900474597 1:2870210-2870232 AGGCTCCTGCCCTCACTTGCTGG + Intergenic
900477099 1:2881150-2881172 AGGCTCCGGCCAGCGTGTGCGGG + Intergenic
901017120 1:6238214-6238236 GAGCTCCTGCCAGGACCTGCAGG - Intergenic
904333874 1:29784720-29784742 AAACTCCAGCCAGCATGTCCTGG + Intergenic
905925235 1:41745035-41745057 AAGCTCCAGCCAGAACCTGGGGG + Intronic
908915691 1:69123051-69123073 AAGATCCTGTCAGGATGTGCAGG + Intergenic
909067246 1:70950026-70950048 TAACTCCTGCCAGTACGTGCTGG - Intronic
916502868 1:165401462-165401484 GGCCTCCTGCCAGCAGGTGCAGG - Intronic
917428127 1:174937120-174937142 AGGCTCCTGCCACCACGCCCGGG + Intronic
919040917 1:192387505-192387527 AATTTCCTGCCAGCACTTCCTGG - Intergenic
922894071 1:229087473-229087495 AAGCACATGCCAGCATGTGGAGG - Intergenic
923053023 1:230402015-230402037 AAGCTGCTGCCAGGAAGTGGTGG + Intronic
1062892534 10:1074942-1074964 AAGCACCTGCACGCACGTGCGGG - Intronic
1065770414 10:29072863-29072885 GAGCTGCTGCAGGCACGTGCAGG + Intergenic
1071823935 10:89305778-89305800 AAACTCCTGCTACCACATGCAGG + Intronic
1076403936 10:130200372-130200394 CAGCTCCTGGCAGCACAAGCTGG - Intergenic
1077237692 11:1489783-1489805 GAGCTCCTGCCATCAGCTGCTGG + Intronic
1077545250 11:3166373-3166395 AGGCTCCTTCCAGCACCTGAAGG + Intronic
1081734168 11:45391809-45391831 AAGCTCCTCCCAACTCTTGCCGG - Intergenic
1081770826 11:45649783-45649805 GAACGCCTGCCAGCAGGTGCTGG - Exonic
1083184945 11:61012199-61012221 AAGCTCCTGCCAGGCCCCGCAGG + Intronic
1083794543 11:65007546-65007568 AGGCACCAGCAAGCACGTGCTGG - Intergenic
1084088439 11:66865415-66865437 ACGGTGCTGGCAGCACGTGCAGG + Intronic
1084729368 11:71063619-71063641 AAGCTCCCACCAGCACCTCCTGG - Intronic
1087171496 11:95053985-95054007 AGACTCCTGCCTGCACATGCAGG - Intergenic
1088895482 11:114075049-114075071 CAGCCCCTGCTAGCACGTGGGGG - Intronic
1089134357 11:116237507-116237529 AAGCTTCTCCCAGTACATGCTGG + Intergenic
1089311021 11:117558209-117558231 AAGCTGCTGCCAGCACCTACAGG + Intronic
1095540858 12:43307212-43307234 CAGCTCCTTCCAGCAAGTGGAGG - Intergenic
1096009443 12:48200699-48200721 TAGCTTCTGGCAGCACGTGGTGG - Intergenic
1098253201 12:68590156-68590178 AAGCTTCTGCCTGGACATGCAGG - Intergenic
1098989352 12:77047796-77047818 CTGCTCCTGCCAGCACCTTCCGG - Intronic
1106139391 13:26998958-26998980 AAGGTCCTCCCAGGACATGCTGG + Intergenic
1107935924 13:45345346-45345368 AGGCGCCTGCCATCACGTCCAGG - Intergenic
1108704807 13:52975319-52975341 ATGCTACTGCCAGCATTTGCTGG + Intergenic
1108826246 13:54416017-54416039 AAGCTCCACACAGCACTTGCGGG + Intergenic
1112501579 13:99947173-99947195 CGGCTCCTGCCACCAGGTGCTGG + Intergenic
1114658354 14:24329487-24329509 AAGCCCCTGCCAGCAGGGCCAGG + Exonic
1117863819 14:60123420-60123442 AAGTTCTTGCCAGCACCTGGTGG + Intronic
1121329290 14:93039999-93040021 GTGCTCCTGCCAGCCCCTGCTGG + Intronic
1122203209 14:100135111-100135133 AACCTCATCCCAGCACCTGCAGG + Intronic
1123937748 15:25202211-25202233 TAGCTCCGGCCAGCACCTGATGG + Intergenic
1124355995 15:28995140-28995162 AAGCTACTGCCAGCAGGCTCGGG - Intronic
1129336072 15:74852917-74852939 CAGCAGCTGCCAGCAGGTGCAGG - Intronic
1129641478 15:77383165-77383187 AGGCTCCCGCCACCACGTCCAGG + Intronic
1130274938 15:82471526-82471548 AATCTTCTGCCAGCAAGTCCAGG + Intergenic
1130467285 15:84198895-84198917 AAACTTCTGCCAGCAAGTCCAGG + Intergenic
1130496976 15:84474641-84474663 AAACTTCTGCCAGCAAGTCCAGG - Intergenic
1130589582 15:85203493-85203515 AATCTTCTGCCAGCAAGTCCAGG + Intergenic
1131616957 15:94026450-94026472 AAGCAGCTGCCAGGACTTGCAGG - Intergenic
1131890420 15:96966113-96966135 AAGCGCCTGCCATCACGCCCAGG - Intergenic
1131986841 15:98051218-98051240 AAGCTCCTTCCTGCAAGGGCTGG - Intergenic
1132421855 15:101676819-101676841 AAGTTCCTGGGTGCACGTGCAGG + Intronic
1132544428 16:526926-526948 ACTCTCCTGCCAGCAGCTGCTGG - Intergenic
1133386461 16:5374059-5374081 AGGCACCTGCCATCATGTGCAGG + Intergenic
1133740049 16:8644611-8644633 CCGCTCCTGCCTGCACGCGCTGG + Exonic
1134197280 16:12168958-12168980 AAGCTCTCCCCAGCACGTGCAGG - Intronic
1136402561 16:30026535-30026557 AGGCTCCTGCCAGCACCAGCAGG + Intronic
1139336651 16:66236600-66236622 AGGCTCCTGACAGCTCATGCCGG + Intergenic
1139671264 16:68493542-68493564 GGGCTCTTGCCAGCACGAGCTGG + Intergenic
1140274349 16:73495561-73495583 AATCTCCAGCCAGCAGGTGAAGG - Intergenic
1141525250 16:84606956-84606978 AGGCTTTTCCCAGCACGTGCTGG - Intronic
1141682080 16:85550688-85550710 AATAGCCTCCCAGCACGTGCTGG - Intergenic
1142196954 16:88743358-88743380 AAGCTCCTGCCAGCACGTGCCGG - Intronic
1142540612 17:655851-655873 CACCTCCTGCCAGCATGTGCAGG + Exonic
1144573572 17:16415665-16415687 AAGCTCCAGCAAGCAGGTTCTGG - Exonic
1144856803 17:18273532-18273554 GAGCTCCTTCCAGCACTGGCTGG + Intronic
1145269865 17:21399085-21399107 AGCCTCCTGCCAGCATCTGCAGG - Intronic
1146141558 17:30372556-30372578 GAGTTCCTGCCATCACATGCTGG - Intergenic
1147163131 17:38579167-38579189 AAGCTGGTGCCAGCAGGTGAGGG + Intronic
1148046715 17:44749164-44749186 CAGCCCCTGCCAGCCAGTGCGGG + Intronic
1149116248 17:53099909-53099931 AAGTTCCTCCCAGCACTTGGTGG - Intergenic
1152603710 17:81278419-81278441 AAGGTCCTGCCAGCAGCTGCTGG + Intronic
1152637350 17:81435574-81435596 AAGCTCCTGCTAGAACGTCGGGG - Intronic
1153331391 18:3879111-3879133 ACGCTCCTGCCAGTACCTGCAGG - Exonic
1157331235 18:46705271-46705293 AAGCCCCTTCCAGCACCAGCTGG + Intronic
1157680789 18:49603953-49603975 AAGCGCATTCCAGCAGGTGCAGG - Intergenic
1160586276 18:79915256-79915278 AAGCTCCCGGCAGCACGGGCGGG + Intronic
1160599413 18:80001294-80001316 AAACTCCTGCCTGGACGTCCAGG - Intronic
1160825066 19:1075873-1075895 TAGCTCCTTCCAGCACATACCGG + Intronic
1161744037 19:6043909-6043931 GAGCTCCACCCAGCAGGTGCGGG + Intronic
1162010567 19:7811328-7811350 AGGCTCCTGCCACCACGGCCAGG + Intergenic
1162952634 19:14081045-14081067 AAGCTCCTGCGAGCAAGTGGCGG - Intergenic
1164070165 19:21760349-21760371 AGGCACCTGCCATCACATGCAGG - Intronic
1168043744 19:53779250-53779272 AGGCTCCTGCCACTACGTCCAGG + Intergenic
934991533 2:98925088-98925110 AAGCTGCTGCCAGTAGGGGCTGG + Intronic
935479065 2:103562152-103562174 AAACTCCTGCCTGCACATCCAGG + Intergenic
935803921 2:106728153-106728175 CAGCTCCATTCAGCACGTGCAGG + Intergenic
942959635 2:181814405-181814427 ATGCTCCATCCAGCACATGCTGG + Intergenic
944716233 2:202377556-202377578 TAGCTCCGGCCGGCACGTCCCGG + Intronic
945319746 2:208407260-208407282 AATTGCCTGCCAGCACCTGCCGG - Intronic
946156514 2:217810159-217810181 GACCTCCAGCCTGCACGTGCAGG + Intronic
948818501 2:240526189-240526211 AAGCTCCTGCGGGCACCAGCTGG + Intronic
1169691747 20:8340271-8340293 AAGCTCCTGCTAGCTTGAGCTGG + Intronic
1173499230 20:43540246-43540268 AAGCTCCTGCCAGGAGTAGCGGG + Exonic
1174163677 20:48569651-48569673 AAGCTCCTTCCAGGAGGTGAGGG + Intergenic
1178471617 21:32898665-32898687 ATGCTCCTGCCAGCTAGTGCTGG - Intergenic
1179722881 21:43325340-43325362 AAGCTGAGGCCACCACGTGCAGG + Intergenic
1179921520 21:44510164-44510186 AAGCTTCTGCCAGCACCTTGGGG + Intronic
1180723585 22:17927865-17927887 AAGCACCTCCCACCAGGTGCTGG + Intronic
1181672038 22:24430212-24430234 CAGCTGCTGCCAGCACATCCCGG - Intronic
1182449488 22:30410495-30410517 ACCCTCCTGCCAGCCCATGCTGG - Intronic
1184301937 22:43566584-43566606 AAGCTCCTGCCAGCAGGTGCTGG + Intronic
1184302147 22:43567862-43567884 AAGCTCCTGCCAGCCGGTGCTGG + Intronic
949964044 3:9340140-9340162 AAGATTCTGCCAGCACTTTCAGG + Intronic
950210603 3:11120347-11120369 AAGCTCCTGCCAGCACCCAAAGG + Intergenic
950771395 3:15314398-15314420 AAGCCCCTCCCAGCAGGAGCTGG - Intronic
954084776 3:48235492-48235514 AGGCACCTGCCACCACGTCCGGG + Intergenic
954703191 3:52463088-52463110 AAGCTCCTGCTAACAGGTACAGG - Intronic
957293432 3:78306669-78306691 AGGCTTCTGCCAGGACATGCAGG - Intergenic
961387114 3:126528962-126528984 AAGCTCCTGCCAGCAGGCATAGG - Intronic
961431847 3:126889260-126889282 CAGCTCCTGCCACCACCTTCAGG - Intronic
961558746 3:127714422-127714444 GAGCTGCTGCCAGCAGGTTCAGG + Intronic
964852069 3:161105369-161105391 AAGCCCCTGGCTGCACGCGCGGG + Intronic
965198853 3:165631371-165631393 AAGCTCCTGCCTGGACATCCAGG - Intergenic
968271978 3:197410034-197410056 AAGCGCCAGACAGTACGTGCAGG + Intergenic
968668517 4:1834731-1834753 AAGCGCCAGCCAGCACCTGGGGG + Intronic
969264860 4:6057716-6057738 CAGCTCCTCCCAGCAGGTGATGG + Intronic
980671112 4:136008520-136008542 GAGCACCTGCCAGCCAGTGCTGG - Intergenic
984061399 4:174992379-174992401 AAGCTGATGCCAGCACGGGTTGG + Intergenic
984446533 4:179843835-179843857 AAGCAACTGTCAGCACATGCAGG + Intergenic
984888566 4:184472964-184472986 ATGCCCCTCCCAGCACGCGCCGG - Intronic
985107673 4:186514858-186514880 GAGCTCATGCCAGCAGGTCCAGG - Intronic
991602582 5:68368272-68368294 GAGGTCCTGGCAACACGTGCAGG + Intergenic
995369402 5:111401944-111401966 ATGCTCCAGCCAGCCAGTGCTGG + Intronic
996029296 5:118687032-118687054 AATCTCCAGCCAGGACGTGGTGG - Intergenic
997347034 5:133199481-133199503 CAGCCCCTGGCTGCACGTGCAGG - Exonic
997595017 5:135101537-135101559 AGGTTCCTGCCTGCACATGCTGG + Intronic
1001997112 5:176171201-176171223 AAGCTTCTCCGAGCACGTGCAGG - Intergenic
1002710156 5:181190482-181190504 AGGAGCCTGCCAGCACGTTCGGG - Intergenic
1003581099 6:7341672-7341694 TAGCTCCTGCCTGTACGTGAAGG - Intronic
1004950156 6:20660558-20660580 AAGATCCTGCCAGCATGACCAGG - Intronic
1005339730 6:24831857-24831879 AAGATCCTGCCAGACCCTGCTGG - Intronic
1007398251 6:41589500-41589522 AAGCTCCAGCCAGGACGCACTGG + Intronic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1008199537 6:48569063-48569085 GAGCTCCTCCCAGCTCTTGCTGG + Intergenic
1011381030 6:86742410-86742432 TGGCTCCTGCCAGAACATGCTGG + Intergenic
1011895263 6:92217167-92217189 AAACTTCTGCCTGCATGTGCAGG - Intergenic
1012392795 6:98762225-98762247 AAGCACATGCCACCACATGCAGG + Intergenic
1017345777 6:153379207-153379229 TGGCTTCTGCCAGCACATGCTGG - Intergenic
1018952300 6:168387222-168387244 AAGCCCCTGCAGGCATGTGCTGG + Intergenic
1019497712 7:1348135-1348157 AACCTCCTGCCTCCGCGTGCAGG + Intergenic
1019524398 7:1474260-1474282 GAGCTGCTTCCTGCACGTGCTGG - Exonic
1019884787 7:3894401-3894423 AAGCTCCTGACAGCCTCTGCAGG + Intronic
1023601604 7:41886449-41886471 TAGCTCCTGACAGCGCCTGCCGG - Intergenic
1026807785 7:73438600-73438622 ATGCACATGCCAGCACGTGTGGG - Intergenic
1027248112 7:76380638-76380660 AAGCACGTGCCACCACGTCCTGG + Intergenic
1027486548 7:78768990-78769012 AAGCTCCAGCCAGCAGAGGCAGG - Intronic
1028341356 7:89723794-89723816 AATCACCTTCCAGCACCTGCTGG + Intergenic
1029387503 7:100253248-100253270 AGGCTCCTGCCACCACGCCCAGG + Intronic
1029618176 7:101673026-101673048 AAGCTGCTGAGAGCACGTCCAGG - Intergenic
1029930918 7:104370200-104370222 AGGCTGCTGCCAGCTGGTGCTGG + Intronic
1031531784 7:122885773-122885795 CAGCTCCTGCCAGCCCAGGCGGG + Intronic
1035871446 8:3140044-3140066 AGGCGCCTGCCATCATGTGCCGG + Intronic
1036786795 8:11693015-11693037 AGGCTTCTGCCAGCGCCTGCGGG + Intronic
1037325773 8:17688649-17688671 AAGCACCTGCCACCAGATGCTGG - Intronic
1039897961 8:41729777-41729799 AGGCTCCTGCCAGCCCCTGGGGG + Intronic
1040284217 8:46091770-46091792 GAGTTTCTGCCTGCACGTGCTGG - Intergenic
1045842615 8:106597347-106597369 AGGCTCCTTCCAGAACCTGCAGG + Intronic
1048369951 8:133768627-133768649 AAGCCCCAGCCAGCAGATGCTGG + Intergenic
1051070858 9:13165074-13165096 ACGATCCTGTCTGCACGTGCAGG - Intronic
1057198894 9:93130027-93130049 TAGCTCCTGGCAGCTCCTGCTGG - Intronic
1062047867 9:134432723-134432745 GTGCTCCTGCCCTCACGTGCCGG - Intronic
1062419584 9:136473515-136473537 AAGCTGCTGTCAGCACGTGGTGG - Intronic
1062434566 9:136541169-136541191 AAGCACCTGGCAGCACATGCTGG - Intronic
1196336959 X:114548631-114548653 AAGCTCCTGGATACACGTGCAGG + Intergenic
1199051251 X:143239562-143239584 ATGCCCCTGCAAGCATGTGCAGG - Intergenic